Morpholino
MO3-fzd2
- ID
- ZDB-MRPHLNO-051207-3
- Name
- MO3-fzd2
- Previous Names
-
- fz2 MO-2 (1)
- Target
- Sequence
-
5' - CACACACACTTCCACTCGCCTGCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-fzd2
No data available
Phenotype
Phenotype resulting from MO3-fzd2
Phenotype | Fish | Figures |
---|---|---|
notochord undulate, abnormal | WT + MO3-fzd2 |
text only
from Sumanas et al., 2001 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO3-fzd2
1 - 5 of 35 Show all
Citations
- Oishi, I., Kawakami, Y., Raya, A., Callol-Massot, C., and Izpisúa Belmonte, J.C. (2006) Regulation of primary cilia formation and left-right patterning in zebrafish by a noncanonical Wnt signaling mediator, duboraya. Nature Genetics. 38(11):1316-1322
- Kim, H.J., Schleiffarth, J.R., Jessurun, J., Sumanas, S., Petryk, A., Lin, S., and Ekker, S.C. (2005) Wnt5 signaling in vertebrate pancreas development. BMC Biology. 3:23
- Kilian, B., Mansukoski, H., Barbosa, F.C., Ulrich, F., Tada, M., and Heisenberg, C.P. (2003) The role of Ppt/Wnt5 in regulating cell shape and movement during zebrafish gastrulation. Mechanisms of Development. 120(4):467-476
- Sumanas, S., Kim, H.J., Hermanson, S., and Ekker, S.C. (2001) Zebrafish frizzled-2 morphant displays defects in body axis elongation. Genesis (New York, N.Y. : 2000). 30(3):114-118
1 - 4 of 4
Show