Morpholino

MO1-gata4

ID
ZDB-MRPHLNO-051128-1
Name
MO1-gata4
Previous Names
None
Target
Sequence
5' - TCCACAGGTGAGCGATTATTGCTCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The published sequence contains typos. This sequence has been confirmed by an author.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gata4
No data available
Phenotype
Phenotype resulting from MO1-gata4
Phenotype Fish Figures
caudal fin blood circulation decreased process quality, abnormal sd2Tg + MO1-gata4 Fig. 2 with imageFig. 7 with image from Torregroza et al., 2012
caudal vein plexus malformed, abnormal sd2Tg; y1Tg + MO1-gata4 Fig. 2 with imageFig. 3 with image from Torregroza et al., 2012
embryonic heart tube left/right pattern formation disrupted, abnormal TL + MO1-gata4 Fig. 5 with image from Lin et al., 2009
heart malformed, abnormal twu34Tg + MO1-gata4 Fig. S4 with image from Gupta et al., 2013
heart looping decreased occurrence, abnormal twu34Tg + MO1-gata4 Fig. S4 with image from Gupta et al., 2013
heart looping disrupted, abnormal TL + MO1-gata4 Fig. 5 with image from Lin et al., 2009
neuromast decreased amount, abnormal WT + MO1-gata4 Fig. 6 with imageFig. 7 with image from Torregroza et al., 2012
neuromast deposition decreased process quality, abnormal zf106Tg + MO1-gata4 Fig. 6 with image from Torregroza et al., 2012
neuromast deposition disrupted, abnormal zf106Tg + MO1-gata4 Fig. 6 with image from Torregroza et al., 2012
neuromast primordium migration delayed, abnormal zf106Tg + MO1-gata4 Fig. 6 with image from Torregroza et al., 2012
neuromast primordium migration process quality, abnormal zf106Tg + MO1-gata4 Fig. 6 with image from Torregroza et al., 2012
posterior lateral line lacks parts or has fewer parts of type neuromast, abnormal WT + MO1-gata4 Fig. 6 with imageFig. 7 with image from Torregroza et al., 2012
posterior lateral line neuron decreased branchiness, abnormal WT + MO1-gata4 Fig. 6 with image from Torregroza et al., 2012
posterior lateral line neuron projection mislocalised, abnormal WT + MO1-gata4 Fig. 6 with image from Torregroza et al., 2012
trunk lacks parts or has fewer parts of type neuromast, abnormal WT + MO1-gata4 Fig. 6 with image from Torregroza et al., 2012
Phenotype of all Fish created by or utilizing MO1-gata4
Phenotype Fish Conditions Figures
heart looping disrupted, abnormal TL + MO1-gata4 standard conditions Fig. 5 with image from Lin et al., 2009
embryonic heart tube left/right pattern formation disrupted, abnormal TL + MO1-gata4 standard conditions Fig. 5 with image from Lin et al., 2009
posterior lateral line neuron projection mislocalised, abnormal WT + MO1-gata4 standard conditions Fig. 6 with image from Torregroza et al., 2012
posterior lateral line neuron decreased branchiness, abnormal WT + MO1-gata4 standard conditions Fig. 6 with image from Torregroza et al., 2012
trunk lacks parts or has fewer parts of type neuromast, abnormal WT + MO1-gata4 standard conditions Fig. 6 with image from Torregroza et al., 2012
posterior lateral line lacks parts or has fewer parts of type neuromast, abnormal WT + MO1-gata4 standard conditions Fig. 6 with imageFig. 7 with image from Torregroza et al., 2012
neuromast decreased amount, abnormal WT + MO1-gata4 standard conditions Fig. 6 with imageFig. 7 with image from Torregroza et al., 2012
caudal fin blood circulation decreased process quality, abnormal sd2Tg + MO1-gata4 standard conditions Fig. 7 with image from Torregroza et al., 2012
heart malformed, abnormal twu34Tg + MO1-gata4 standard conditions Fig. S4 with image from Gupta et al., 2013
heart looping decreased occurrence, abnormal twu34Tg + MO1-gata4 standard conditions Fig. S4 with image from Gupta et al., 2013
neuromast primordium migration process quality, abnormal zf106Tg + MO1-gata4 standard conditions Fig. 6 with image from Torregroza et al., 2012
neuromast deposition decreased process quality, abnormal zf106Tg + MO1-gata4 standard conditions Fig. 6 with image from Torregroza et al., 2012
neuromast primordium migration delayed, abnormal zf106Tg + MO1-gata4 standard conditions Fig. 6 with image from Torregroza et al., 2012
neuromast deposition disrupted, abnormal zf106Tg + MO1-gata4 standard conditions Fig. 6 with image from Torregroza et al., 2012
caudal fin blood circulation decreased process quality, abnormal sd2Tg; y1Tg + MO1-gata4 standard conditions Fig. 2 with image from Torregroza et al., 2012
caudal vein plexus malformed, abnormal sd2Tg; y1Tg + MO1-gata4 standard conditions Fig. 2 with imageFig. 3 with image from Torregroza et al., 2012
swim bladder inflation disrupted, abnormal TL + MO1-gata4 + MO3-atoh8 standard conditions Fig. 3 from Rawnsley et al., 2013
swim bladder uninflated, abnormal TL + MO1-gata4 + MO3-atoh8 standard conditions Fig. 3 from Rawnsley et al., 2013
heart tube shape, abnormal TL + MO1-gata4 + MO3-atoh8 standard conditions Fig. 3 from Rawnsley et al., 2013
heart looping disrupted, abnormal TL + MO1-gata4 + MO3-atoh8 standard conditions Fig. 3 from Rawnsley et al., 2013
heart looping disrupted, abnormal TL + MO1-gata4 + MO3-zfpm1 standard conditions Fig. 3 from Rawnsley et al., 2013
heart tube shape, abnormal TL + MO1-gata4 + MO3-zfpm1 standard conditions Fig. 3 from Rawnsley et al., 2013
liver hypoplastic, abnormal WT + MO1-gata4 + MO1-mgaa standard conditions Fig. 11 with image from Rikin et al., 2010
heart looping disrupted, abnormal TL + MO1-gata4 + MO3-atoh8 + MO3-zfpm1 standard conditions Fig. 3 from Rawnsley et al., 2013
heart tube shape, abnormal TL + MO1-gata4 + MO3-atoh8 + MO3-zfpm1 standard conditions Fig. 3 from Rawnsley et al., 2013
extension degenerate, abnormal twu34Tg + MO1-gata4 + MO1-mgaa standard conditions Fig. 8 with image from Rikin et al., 2010
Citations