Morpholino

MO4-cxcl12a

ID
ZDB-MRPHLNO-051028-3
Name
MO4-cxcl12a
Previous Names
  • S1a-2-MO (1)
  • SDF-1a-2-MO (1)
Target
Sequence
5' - TTGAGATCCATGTTTGCAGTGTGAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking morpholino
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-cxcl12a
Expressed Gene Anatomy Figures
ddx4 Fig. 3 with image from Gross-Thebing et al., 2017
etv4 Fig. 6 with image from Neelathi et al., 2018
lef1 Fig. 6 with image from Neelathi et al., 2018
myod1 Fig. 3 with image from Gross-Thebing et al., 2017
snai1b Fig. 2 with image,  Fig. 6 with image from Neelathi et al., 2018
Phenotype
Phenotype resulting from MO4-cxcl12a
Phenotype Fish Figures
axon guidance process quality, abnormal WT + MO4-cxcl12a Fig. S4 from Hollway et al., 2007
hypaxial myotome region aplastic, abnormal zf13Tg + MO4-cxcl12a Fig. 6 from Hollway et al., 2007
muscle cell migration arrested, abnormal WT + MO4-cxcl12a Fig. 6 from Hollway et al., 2007
muscle cell migration disrupted, abnormal WT + MO4-cxcl12a Fig. S5 from Hollway et al., 2007
myotome cellular quality, abnormal WT + MO4-cxcl12a Fig. S5 from Hollway et al., 2007
pectoral fin musculature aplastic, abnormal zf13Tg + MO4-cxcl12a Fig. 6 from Hollway et al., 2007
posterior lateral line ganglion fused with posterior lateral line placode, abnormal zf106Tg + MO4-cxcl12a Fig. 6 with image from Neelathi et al., 2018
posterior lateral line primordium snai1b expression absent, abnormal zf106Tg + MO4-cxcl12a Fig. 2 with image from Neelathi et al., 2018
posterior lateral line primordium lef1 expression increased amount, abnormal zf106Tg + MO4-cxcl12a Fig. 6 with image from Neelathi et al., 2018
posterior lateral line primordium lef1 expression increased distribution, abnormal zf106Tg + MO4-cxcl12a Fig. 6 with image from Neelathi et al., 2018
posterior lateral line primordium central region etv4 expression increased amount, abnormal zf106Tg + MO4-cxcl12a Fig. 6 with image from Neelathi et al., 2018
posterior lateral line primordium central region etv4 expression mislocalised, abnormal zf106Tg + MO4-cxcl12a Fig. 6 with image from Neelathi et al., 2018
posterior lateral line primordium posterior lateral line development decreased process quality, abnormal zf106Tg + MO4-cxcl12a Fig. 2 with image from Neelathi et al., 2018
posterior lateral line primordium posterior lateral line neuromast primordium migration arrested, abnormal zf106Tg + MO4-cxcl12a Fig. 6 with image from Neelathi et al., 2018
primordial germ cell cell migration decreased occurrence, abnormal mu7Tg + MO4-cxcl12a Fig. 3 with image from Gross-Thebing et al., 2017
somite cellular quality, abnormal WT + MO4-cxcl12a Fig. 6 from Hollway et al., 2007
trigeminal ganglion axon position, abnormal WT + MO4-cxcl12a Fig. S4 from Hollway et al., 2007
Phenotype of all Fish created by or utilizing MO4-cxcl12a
Phenotype Fish Conditions Figures
trigeminal ganglion axon position, abnormal WT + MO4-cxcl12a standard conditions Fig. S4 from Hollway et al., 2007
myotome cellular quality, abnormal WT + MO4-cxcl12a standard conditions Fig. S5 from Hollway et al., 2007
muscle cell migration disrupted, abnormal WT + MO4-cxcl12a standard conditions Fig. S5 from Hollway et al., 2007
somite cellular quality, abnormal WT + MO4-cxcl12a standard conditions Fig. 6 from Hollway et al., 2007
axon guidance process quality, abnormal WT + MO4-cxcl12a standard conditions Fig. S4 from Hollway et al., 2007
muscle cell migration arrested, abnormal WT + MO4-cxcl12a standard conditions Fig. 6 from Hollway et al., 2007
primordial germ cell cell migration decreased occurrence, abnormal mu7Tg + MO4-cxcl12a standard conditions Fig. 3 with image from Gross-Thebing et al., 2017
hypaxial myotome region aplastic, abnormal zf13Tg + MO4-cxcl12a standard conditions Fig. 6 from Hollway et al., 2007
pectoral fin musculature aplastic, abnormal zf13Tg + MO4-cxcl12a standard conditions Fig. 6 from Hollway et al., 2007
posterior lateral line primordium central region etv4 expression increased amount, abnormal zf106Tg + MO4-cxcl12a standard conditions Fig. 6 with image from Neelathi et al., 2018
posterior lateral line primordium lef1 expression increased distribution, abnormal zf106Tg + MO4-cxcl12a standard conditions Fig. 6 with image from Neelathi et al., 2018
posterior lateral line primordium central region etv4 expression mislocalised, abnormal zf106Tg + MO4-cxcl12a standard conditions Fig. 6 with image from Neelathi et al., 2018
posterior lateral line primordium snai1b expression absent, abnormal zf106Tg + MO4-cxcl12a standard conditions Fig. 2 with image from Neelathi et al., 2018
posterior lateral line primordium posterior lateral line neuromast primordium migration arrested, abnormal zf106Tg + MO4-cxcl12a standard conditions Fig. 6 with image from Neelathi et al., 2018
posterior lateral line primordium lef1 expression increased amount, abnormal zf106Tg + MO4-cxcl12a standard conditions Fig. 6 with image from Neelathi et al., 2018
posterior lateral line primordium posterior lateral line development decreased process quality, abnormal zf106Tg + MO4-cxcl12a standard conditions Fig. 2 with image from Neelathi et al., 2018
posterior lateral line ganglion fused with posterior lateral line placode, abnormal zf106Tg + MO4-cxcl12a standard conditions Fig. 6 with image from Neelathi et al., 2018
retinal ganglion cell axon guidance disrupted, abnormal robo2te284/te284 + MO4-cxcl12a standard conditions Fig. 2,  Fig. 5 from Chalasani et al., 2007
cranial nerve III mislocalised, abnormal robo2te284/te284 + MO4-cxcl12a standard conditions Fig. 2,  Fig. 5 from Chalasani et al., 2007
retinal ganglion cell axon guidance disrupted, abnormal robo2ti272z/ti272z + MO4-cxcl12a standard conditions Fig. 2,  Fig. 5 from Chalasani et al., 2007
cranial nerve III mislocalised, abnormal robo2ti272z/ti272z + MO4-cxcl12a standard conditions Fig. 2,  Fig. 5 from Chalasani et al., 2007
axon guidance process quality, abnormal WT + MO1-cxcl12b + MO4-cxcl12a standard conditions Fig. S4 from Hollway et al., 2007
somite cellular quality, abnormal WT + MO1-cxcl12b + MO4-cxcl12a standard conditions Fig. 6 from Hollway et al., 2007
trigeminal ganglion axon position, abnormal WT + MO1-cxcl12b + MO4-cxcl12a standard conditions Fig. S4 from Hollway et al., 2007
somite cellular quality, abnormal mik1Tg + MO4-cxcl12a heat shock text only from Hollway et al., 2007
primordial germ cell regulation of intracellular pH process quality, abnormal mu2Tg + MO4-cxcl12a + MO5-cxcl12b standard conditions Fig. 2 with image from Tarbashevich et al., 2015
primordial germ cell establishment of cell polarity decreased occurrence, abnormal mu2Tg + MO4-cxcl12a + MO5-cxcl12b standard conditions Fig. 2 with image from Tarbashevich et al., 2015
primordial germ cell regulation of intracellular pH process quality, abnormal mu6Tg + MO4-cxcl12a + MO5-cxcl12b standard conditions Fig. 2 with image from Tarbashevich et al., 2015
primordial germ cell establishment of cell polarity decreased occurrence, abnormal mu6Tg + MO4-cxcl12a + MO5-cxcl12b standard conditions Fig. 2 with image from Tarbashevich et al., 2015
primordial germ cell ddx4 expression absent, abnormal mu7Tg + MO1-dnd1 + MO4-cxcl12a standard conditions Fig. 3 with image from Gross-Thebing et al., 2017
primordial germ cell myod1 expression increased amount, abnormal mu7Tg + MO1-dnd1 + MO4-cxcl12a standard conditions Fig. 3 with image from Gross-Thebing et al., 2017
neutrophil chemotaxis increased occurrence, abnormal uwm3Tg + MO4-cxcl12a standard conditions Fig. 7 from Walters et al., 2010
primordial germ cell TFP expression increased amount, abnormal ka14Tg; mu6Tg + MO1-dnd1 + MO4-cxcl12a standard conditions Fig. 3 with image,  Fig. 6 with image from Gross-Thebing et al., 2017
primordial germ cell mislocalised, abnormal ka14Tg; mu6Tg + MO1-dnd1 + MO4-cxcl12a standard conditions Fig. 6 with image from Gross-Thebing et al., 2017
primordial germ cell morphology, abnormal ka14Tg; mu6Tg + MO1-dnd1 + MO4-cxcl12a standard conditions Fig. 6 with image from Gross-Thebing et al., 2017
primordial germ cell transformed to somatic cell, abnormal ka14Tg; mu6Tg + MO1-dnd1 + MO4-cxcl12a standard conditions Fig. 6 with image from Gross-Thebing et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.