Morpholino
MO2-nrp1a
- ID
- ZDB-MRPHLNO-050906-3
- Name
- MO2-nrp1a
- Previous Names
- Target
- Sequence
-
5' - GAATCCTGGAGTTCGGAGTGCGGAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-nrp1a
No data available
Phenotype
Phenotype resulting from MO2-nrp1a
1 - 5 of 26 Show all
Phenotype of all Fish created by or utilizing MO2-nrp1a
1 - 5 of 54 Show all
Citations
- Liu, Z.Z., Liu, L.Y., Zhu, L.Y., Zhu, J., Luo, J.Y., Wang, Y.F., Xu, H.A. (2024) Plexin B3 guides axons to cross the midline in vivo. Frontiers in Cellular Neuroscience. 18:12929691292969
- Guo, Y., Oliveros, C.F., Ohshima, T. (2022) CRMP2 and CRMP4 are required for the formation of commissural tracts in the developing zebrafish forebrain. Developmental Neurobiology. 82(6):533-544
- Liu, Z.Z., Zhu, J., Wang, C.L., Wang, X., Han, Y.Y., Liu, L.Y., Xu, H.A. (2018) CRMP2 and CRMP4 Are Differentially Required for Axon Guidance and Growth in Zebrafish Retinal Neurons. Neural Plasticity. 2018:8791304
- Hamm, M.J., Kirchmaier, B.C., Herzog, W. (2016) Sema3d controls collective endothelial cell migration by distinct mechanisms via Nrp1 and PlxnD1. The Journal of cell biology. 215(3):415-430
- Hörnberg, H., Cioni, J.M., Harris, W.A., Holt, C.E. (2016) Hermes Regulates Axon Sorting in the Optic Tract by Post-Trancriptional Regulation of Neuropilin 1. The Journal of neuroscience : the official journal of the Society for Neuroscience. 36:12697-12706
- Balastik, M., Zhou, X. Z., Alberich-Jorda, M., Weissova, R., Žiak, J., Pazyra-Murphy, M. F., Cosker, K. E., Machonova, O., Kozmikova, I., Chen, C. H., Pastorino, L., Asara, J. M., Cole, A., Sutherland, C., Segal, R. A., Lu, K.P. (2015) Prolyl Isomerase Pin1 Regulates Axon Guidance by Stabilizing CRMP2A Selectively in Distal Axons.. Cell Reports. 13(4):812-28
- Delcourt, N., Quevedo, C., Nonne, C., Fons, P., O'Brien, D., Loyaux, D., Diez, M., Autelitano, F., Guillemot, J.C., Ferrara, P., Muriana, A., Callol, C., Hérault, J.P., Herbert, J.M., Favre, G., Bono, F. (2015) Targeted Identification of Sialoglycoproteins in Hypoxic Endothelial Cells and Validation in Zebrafish Reveal Roles for Proteins in Angiogenesis. The Journal of biological chemistry. 290(6):3405-17
- Fantin, A., Lampropoulou, A., Gestri, G., Raimondi, C., Senatore, V., Zachary, I., Ruhrberg, C. (2015) NRP1 Regulates CDC42 Activation to Promote Filopodia Formation in Endothelial Tip Cells. Cell Reports. 11(10):1577-90
- Hirota, S., Clements, T.P., Tang, L.K., Morales, J.E., Lee, H.S., Oh, S.P., Rivera, G.M., Wagner, D.S., McCarty, J.H. (2015) Neuropilin 1 balances β8 integrin-activated TGFβ signaling to control sprouting angiogenesis in the brain. Development (Cambridge, England). 142:4363-73
- Cantu, J.A., Flowers, G.P., and Topczewski, J. (2013) Notum homolog plays a novel role in primary motor innervation. The Journal of neuroscience : the official journal of the Society for Neuroscience. 33(5):2177-2187
1 - 10 of 23
Show