Morpholino

MO2-nrp1a

ID
ZDB-MRPHLNO-050906-3
Name
MO2-nrp1a
Previous Names
  • 1AMO (1)
  • MO-np-1 (1)
  • nrp1a MO1 (1)
  • nrp1a/b MO (1)
Target
Sequence
5' - GAATCCTGGAGTTCGGAGTGCGGAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-nrp1a
No data available
Phenotype
Phenotype resulting from MO2-nrp1a
Phenotype Fish Figures
anterior commissure axon decreased distribution, abnormal RW + MO2-nrp1a Fig. 6 from Guo et al., 2022
anterior commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO2-nrp1a Fig. 6 from Guo et al., 2022
axon extension process quality, abnormal WT + MO2-nrp1a Fig. 9 with image from Chitramuthu et al., 2010
axon guidance disrupted, abnormal AB + MO2-nrp1a Fig. 3 with image from Kuan et al., 2007
brain hemorrhagic, abnormal WT + MO2-nrp1a + MO4-tp53 Fig. 4 with image from Hirota et al., 2015
brain vasculature development process quality, abnormal WT + MO2-nrp1a + MO4-tp53 Fig. 4 with image from Hirota et al., 2015
brain vasculature broken, abnormal WT + MO2-nrp1a + MO4-tp53 Fig. 4 with image from Hirota et al., 2015
CaP motoneuron axon branched, abnormal WT + MO2-nrp1a Fig. 9 with image from Chitramuthu et al., 2010
CaP motoneuron axon decreased length, abnormal AB + MO2-nrp1a text only from Cantu et al., 2013
common cardinal vein actin filament bundle disoriented, abnormal mu240Tg + MO2-nrp1a Fig. 7 with image,  Fig. 8 with image from Hamm et al., 2016
common cardinal vein actin filament bundle organization decreased process quality, abnormal mu240Tg + MO2-nrp1a Fig. 7 with image,  Fig. 8 with image from Hamm et al., 2016
common cardinal vein blood vessel endothelial cell structure, cavities, abnormal mu240Tg + MO2-nrp1a Fig. 8 with image from Hamm et al., 2016
common cardinal vein blood vessel endothelium patchy, abnormal mu240Tg + MO2-nrp1a Fig. 7 with image from Hamm et al., 2016
common cardinal vein cell-cell junction decreased length, abnormal mu240Tg + MO2-nrp1a Fig. 7 with image,  Fig. 8 with image from Hamm et al., 2016
habenula axon misrouted, abnormal AB + MO2-nrp1a Fig. 3 with image from Kuan et al., 2007
interpeduncular nucleus tegmentum structure, abnormal AB + MO2-nrp1a Fig. 3 with image from Kuan et al., 2007
motor neuron axon branchiness, abnormal WT + MO2-nrp1a Fig. 3 with image from Balastik et al., 2015
motor neuron axon truncated, abnormal WT + MO2-nrp1a Fig. 3 with image from Balastik et al., 2015
motor neuron axon guidance process quality, abnormal WT + MO2-nrp1a Fig. 3 with image from Balastik et al., 2015
postoptic commissure axon decreased distribution, abnormal RW + MO2-nrp1a Fig. 6 from Guo et al., 2022
postoptic commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO2-nrp1a Fig. 6 from Guo et al., 2022
retinal neural layer axon mislocalised, abnormal WT + MO2-nrp1a Fig. 4 with image from Liu et al., 2018
retinal neural layer axon guidance disrupted, abnormal WT + MO2-nrp1a Fig. 4 with image from Liu et al., 2018
somite U-shaped, abnormal WT + MO2-nrp1a Fig. 6 from Hillman et al., 2011
venous blood vessel morphogenesis decreased process quality, abnormal mu240Tg + MO2-nrp1a Fig. 7 with image,  Fig. 8 with image from Hamm et al., 2016
whole organism curved ventral, abnormal WT + MO2-nrp1a Fig. 6 from Hillman et al., 2011
Phenotype of all Fish created by or utilizing MO2-nrp1a
Phenotype Fish Conditions Figures
habenula axon misrouted, abnormal AB + MO2-nrp1a standard conditions Fig. 3 with image from Kuan et al., 2007
axon guidance disrupted, abnormal AB + MO2-nrp1a standard conditions Fig. 3 with image from Kuan et al., 2007
CaP motoneuron axon decreased length, abnormal AB + MO2-nrp1a standard conditions text only from Cantu et al., 2013
interpeduncular nucleus tegmentum structure, abnormal AB + MO2-nrp1a standard conditions Fig. 3 with image from Kuan et al., 2007
postoptic commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO2-nrp1a control Fig. 6 from Guo et al., 2022
postoptic commissure axon decreased distribution, abnormal RW + MO2-nrp1a control Fig. 6 from Guo et al., 2022
anterior commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO2-nrp1a control Fig. 6 from Guo et al., 2022
anterior commissure axon decreased distribution, abnormal RW + MO2-nrp1a control Fig. 6 from Guo et al., 2022
axon extension process quality, abnormal WT + MO2-nrp1a standard conditions Fig. 9 with image from Chitramuthu et al., 2010
whole organism curved ventral, abnormal WT + MO2-nrp1a standard conditions Fig. 6 from Hillman et al., 2011
somite U-shaped, abnormal WT + MO2-nrp1a standard conditions Fig. 6 from Hillman et al., 2011
motor neuron axon branchiness, abnormal WT + MO2-nrp1a control Fig. 3 with image from Balastik et al., 2015
motor neuron axon truncated, abnormal WT + MO2-nrp1a control Fig. 3 with image from Balastik et al., 2015
CaP motoneuron axon branched, abnormal WT + MO2-nrp1a standard conditions Fig. 9 with image from Chitramuthu et al., 2010
motor neuron axon guidance process quality, abnormal WT + MO2-nrp1a control Fig. 3 with image from Balastik et al., 2015
retinal neural layer axon guidance disrupted, abnormal WT + MO2-nrp1a standard conditions Fig. 4 with image from Liu et al., 2018
retinal neural layer axon mislocalised, abnormal WT + MO2-nrp1a standard conditions Fig. 4 with image from Liu et al., 2018
brain vasculature development process quality, abnormal WT + MO2-nrp1a + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
brain vasculature broken, abnormal WT + MO2-nrp1a + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
brain hemorrhagic, abnormal WT + MO2-nrp1a + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
common cardinal vein actin filament bundle organization decreased process quality, abnormal mu240Tg + MO2-nrp1a standard conditions Fig. 7 with image,  Fig. 8 with image from Hamm et al., 2016
common cardinal vein actin filament bundle disoriented, abnormal mu240Tg + MO2-nrp1a standard conditions Fig. 7 with image,  Fig. 8 with image from Hamm et al., 2016
common cardinal vein blood vessel endothelial cell structure, cavities, abnormal mu240Tg + MO2-nrp1a standard conditions Fig. 8 with image from Hamm et al., 2016
common cardinal vein blood vessel endothelium patchy, abnormal mu240Tg + MO2-nrp1a standard conditions Fig. 7 with image from Hamm et al., 2016
venous blood vessel morphogenesis decreased process quality, abnormal mu240Tg + MO2-nrp1a standard conditions Fig. 7 with image,  Fig. 8 with image from Hamm et al., 2016
common cardinal vein cell-cell junction decreased length, abnormal mu240Tg + MO2-nrp1a standard conditions Fig. 7 with image,  Fig. 8 with image from Hamm et al., 2016
retina axon ipsilateral to optic tectum, abnormal AB + MO1-plxnb3 + MO2-nrp1a control FIGURE 3 with image from Liu et al., 2024
axon guidance disrupted, abnormal AB + MO1-sema3d + MO2-nrp1a standard conditions Fig. 4 with image from Kuan et al., 2007
interpeduncular nucleus tegmentum structure, abnormal AB + MO1-sema3d + MO2-nrp1a standard conditions Fig. 4 with image from Kuan et al., 2007
habenula axon misrouted, abnormal AB + MO1-sema3d + MO2-nrp1a standard conditions Fig. 4 with image from Kuan et al., 2007
postoptic commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO2-dpysl3 + MO2-nrp1a control Fig. 6 from Guo et al., 2022
anterior commissure axon spatial pattern, exacerbated RW + MO2-dpysl3 + MO2-nrp1a control Fig. 6 from Guo et al., 2022
anterior commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO2-dpysl3 + MO2-nrp1a control Fig. 6 from Guo et al., 2022
postoptic commissure axon spatial pattern, exacerbated RW + MO2-dpysl3 + MO2-nrp1a control Fig. 6 from Guo et al., 2022
postoptic commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO2-nrp1a + MO3-dpysl2b control Fig. 6 from Guo et al., 2022
anterior commissure axon spatial pattern, exacerbated RW + MO2-nrp1a + MO3-dpysl2b control Fig. 6 from Guo et al., 2022
anterior commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO2-nrp1a + MO3-dpysl2b control Fig. 6 from Guo et al., 2022
postoptic commissure axon spatial pattern, exacerbated RW + MO2-nrp1a + MO3-dpysl2b control Fig. 6 from Guo et al., 2022
retinal neural layer axon guidance disrupted, abnormal WT + MO1-dpysl3 + MO2-nrp1a standard conditions Fig. 4 with image from Liu et al., 2018
retinal neural layer axon mislocalised, abnormal WT + MO1-dpysl3 + MO2-nrp1a standard conditions Fig. 4 with image from Liu et al., 2018
motor neuron axon guidance process quality, ameliorated WT + MO2-nrp1a + MO2-pin1 control Fig. 3 with image from Balastik et al., 2015
motor neuron axon branchiness, ameliorated WT + MO2-nrp1a + MO2-pin1 control Fig. 3 with image from Balastik et al., 2015
motor neuron axon truncated, ameliorated WT + MO2-nrp1a + MO2-pin1 control Fig. 3 with image from Balastik et al., 2015
brain hemorrhagic, abnormal WT + MO2-nrp1a + MO3-itgb8 + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
brain vasculature broken, abnormal WT + MO2-nrp1a + MO3-itgb8 + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
brain vasculature development process quality, abnormal WT + MO2-nrp1a + MO3-itgb8 + MO4-tp53 control Fig. 4 with image from Hirota et al., 2015
blood circulation absent, abnormal zf565Tg + MO2-nrp1a + MO4-nrp1b standard conditions Fig. 3 from Delcourt et al., 2015
angiogenesis process quality, abnormal zf565Tg + MO2-nrp1a + MO4-nrp1b standard conditions Fig. 3 from Delcourt et al., 2015
intersegmental vessel angiogenesis process quality, abnormal zf565Tg + MO2-nrp1a + MO4-nrp1b standard conditions Fig. 3 from Delcourt et al., 2015
intersegmental vessel malformed, abnormal zf565Tg + MO2-nrp1a + MO4-nrp1b standard conditions Fig. 3 from Delcourt et al., 2015
dorsal longitudinal anastomotic vessel aplastic, abnormal zf565Tg + MO2-nrp1a + MO4-nrp1b standard conditions Fig. 3 from Delcourt et al., 2015
dorsal longitudinal anastomotic vessel malformed, abnormal zf565Tg + MO2-nrp1a + MO4-nrp1b standard conditions Fig. 3 from Delcourt et al., 2015
dorsomedial optic tract morphology, ameliorated cu2Tg + MO1-rbpms2a + MO1-rbpms2b + MO2-nrp1a control Fig. 4 from Hörnberg et al., 2016
dorsomedial optic tract axon mislocalised, ameliorated cu2Tg + MO1-rbpms2a + MO1-rbpms2b + MO2-nrp1a control Fig. 4 from Hörnberg et al., 2016
Citations