Morpholino
MO1-fgf24
- ID
- ZDB-MRPHLNO-050818-6
- Name
- MO1-fgf24
- Previous Names
-
- fgf24-MOE3I3 (1)
- Target
- Sequence
-
5' - AGGAGACTCCCGTACCGTACTTGCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fgf24
No data available
Phenotype
Phenotype resulting from MO1-fgf24
Phenotype | Fish | Figures |
---|---|---|
fin bud aplastic, abnormal | AB + MO1-fgf24 |
Fig. 5 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-fgf24
1 - 5 of 7 Show all
Citations
- Shin, D., Weidinger, G., Moon, R.T., and Stainier, D.Y. (2012) Intrinsic and extrinsic modifiers of the regulative capacity of the developing liver. Mechanisms of Development. 128(11-12):525-535
- Fischer, S., Filipek-Gorniok, B., and Ledin, J. (2011) Zebrafish Ext2 is necessary for Fgf and Wnt signaling, but not for Hh signaling. BMC Developmental Biology. 11(1):53
- Liu, D.W., Hsu, C.H., Tsai, S.M., Hsiao, C.D., and Wang, W.P. (2011) A variant of fibroblast growth factor receptor 2 (fgfr2) regulates left-right asymmetry in zebrafish. PLoS One. 6(7):e21793
- Neugebauer, J.M., Amack, J.D., Peterson, A.G., Bisgrove, B.W., and Yost, H.J. (2009) FGF signalling during embryo development regulates cilia length in diverse epithelia. Nature. 458(7238):651-654
- Picker, A., Cavodeassi, F., Machate, A., Bernauer, S., Hans, S., Abe, G., Kawakami, K., Wilson, S.W., and Brand, M. (2009) Dynamic coupling of pattern formation and morphogenesis in the developing vertebrate retina. PLoS Biology. 7(10):e1000214
- Manfroid, I., Delporte, F., Baudhuin, A., Motte, P., Neumann, C.J., Voz, M.L., Martial, J.A., and Peers, B. (2007) Reciprocal endoderm-mesoderm interactions mediated by fgf24 and fgf10 govern pancreas development. Development (Cambridge, England). 134(22):4011-4021
- Nechiporuk, A., Linbo, T., and Raible, D.W. (2005) Endoderm-derived Fgf3 is necessary and sufficient for inducing neurogenesis in the epibranchial placodes in zebrafish. Development (Cambridge, England). 132(16):3717-3730
- Draper, B.W., Stock, D.W., and Kimmel, C.B. (2003) Zebrafish fgf24 functions with fgf8 to promote posterior mesodermal development. Development (Cambridge, England). 130(19):4639-4654
1 - 8 of 8
Show