Morpholino

MO1-sox32

ID
ZDB-MRPHLNO-050818-2
Name
MO1-sox32
Previous Names
  • cas-MO (1)
Target
Sequence
5' - GCATCCGGTCGAGATACATGCTGTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sox32
Expressed Gene Anatomy Figures
alcama Fig. 1 with image from Nechiporuk et al., 2005
fgf3 Fig. 4 with image from Nechiporuk et al., 2007
Fig. 2 with image from Nechiporuk et al., 2005
fgf8a Fig. 4 with image from Nechiporuk et al., 2007
foxa3 Fig. 4 with image from Stafford et al., 2006
foxi1 Fig. 4 with image from Nechiporuk et al., 2007
Fig. 5 with image from Nechiporuk et al., 2005
ikzf1 Fig. 3 with image from Peterkin et al., 2009
lcp1 Fig. 3 with image from Peterkin et al., 2009
mpx Fig. 3 with image from Peterkin et al., 2009
myb Fig. 3 with image from Peterkin et al., 2009
neurog1 Fig. 1 with image from Nechiporuk et al., 2005
pax2a Fig. 3 with image from McCarroll et al., 2013
Fig. 4 with image from Nechiporuk et al., 2007
phox2a Fig. 1 with image from Nechiporuk et al., 2005
phox2bb Fig. 1 with image from Nechiporuk et al., 2005
pitx2 Fig. 1-S1 with image from Collins et al., 2018
runx1 Fig. 3 with image from Peterkin et al., 2009
sox32 Fig. 9 from Chung et al., 2011
spi1b Fig. 3 with image from Peterkin et al., 2009
Phenotype
Phenotype resulting from MO1-sox32
Phenotype Fish Figures
axial vasculature morphology, abnormal y1Tg + MO1-sox32 Fig. S4 from Chung et al., 2011
blood circulation decreased rate, abnormal y1Tg + MO1-sox32 Fig. 2 with image from Leslie et al., 2007
cranial ganglion maturation decreased process quality, abnormal w37Tg + MO1-sox32 Fig. 3 with image from McCarroll et al., 2013
definitive hemopoiesis disrupted, abnormal WT + MO1-sox32 Fig. 8 from Chung et al., 2011
ectodermal placode development decreased process quality, abnormal AB + MO1-sox32 Fig. 3 with image from McCarroll et al., 2013
endodermal cell fate specification decreased process quality, abnormal rw0Tg + MO1-sox32 Fig. 2 with image from Sittaramane et al., 2013
glossopharyngeal ganglion poorly differentiated, abnormal w37Tg + MO1-sox32 Fig. 3 with image from McCarroll et al., 2013
glossopharyngeal placode poorly differentiated, abnormal AB + MO1-sox32 Fig. 3 with image from McCarroll et al., 2013
hematopoietic stem cell migration delayed, abnormal WT + MO1-sox32 Fig. 8 from Chung et al., 2011
intersegmental vessel morphology, abnormal y1Tg + MO1-sox32 Fig. S4 from Chung et al., 2011
mesodermal cell migration delayed, abnormal WT + MO1-sox32 Fig. 8 from Chung et al., 2011
rhombomere 5 branchiomotor neuron mislocalised anteriorly, abnormal rw0Tg + MO1-sox32 Fig. 2 with image from Sittaramane et al., 2013
vagal ganglion 1 poorly differentiated, abnormal w37Tg + MO1-sox32 Fig. 3 with image from McCarroll et al., 2013
vagal ganglion 2 poorly differentiated, abnormal w37Tg + MO1-sox32 Fig. 3 with image from McCarroll et al., 2013
vagal ganglion 3 poorly differentiated, abnormal w37Tg + MO1-sox32 Fig. 3 with image from McCarroll et al., 2013
vasculature development disrupted, abnormal y1Tg + MO1-sox32 Fig. S4 from Chung et al., 2011
whole organism sox32 expression increased amount, abnormal WT + MO1-sox32 Fig. 9 from Chung et al., 2011
whole organism lacks all parts of type endoderm, abnormal rw0Tg + MO1-sox32 Fig. 2 with image from Sittaramane et al., 2013
Phenotype of all Fish created by or utilizing MO1-sox32
Phenotype Fish Conditions Figures
ectodermal placode development decreased process quality, abnormal AB + MO1-sox32 standard conditions Fig. 3 with image from McCarroll et al., 2013
glossopharyngeal placode poorly differentiated, abnormal AB + MO1-sox32 standard conditions Fig. 3 with image from McCarroll et al., 2013
whole organism sox32 expression increased amount, abnormal WT + MO1-sox32 standard conditions Fig. 9 from Chung et al., 2011
mesodermal cell migration delayed, abnormal WT + MO1-sox32 standard conditions Fig. 8 from Chung et al., 2011
hematopoietic stem cell migration delayed, abnormal WT + MO1-sox32 standard conditions Fig. 8 from Chung et al., 2011
definitive hemopoiesis disrupted, abnormal WT + MO1-sox32 standard conditions Fig. 8 from Chung et al., 2011
whole organism lacks all parts of type endoderm, abnormal rw0Tg + MO1-sox32 standard conditions Fig. 2 with image from Sittaramane et al., 2013
endodermal cell fate specification decreased process quality, abnormal rw0Tg + MO1-sox32 standard conditions Fig. 2 with image from Sittaramane et al., 2013
rhombomere 5 branchiomotor neuron mislocalised anteriorly, abnormal rw0Tg + MO1-sox32 standard conditions Fig. 2 with image from Sittaramane et al., 2013
vagal ganglion 3 poorly differentiated, abnormal w37Tg + MO1-sox32 standard conditions Fig. 3 with image from McCarroll et al., 2013
glossopharyngeal ganglion poorly differentiated, abnormal w37Tg + MO1-sox32 standard conditions Fig. 3 with image from McCarroll et al., 2013
vagal ganglion 1 poorly differentiated, abnormal w37Tg + MO1-sox32 standard conditions Fig. 3 with image from McCarroll et al., 2013
cranial ganglion maturation decreased process quality, abnormal w37Tg + MO1-sox32 standard conditions Fig. 3 with image from McCarroll et al., 2013
vagal ganglion 2 poorly differentiated, abnormal w37Tg + MO1-sox32 standard conditions Fig. 3 with image from McCarroll et al., 2013
intersegmental vessel morphology, abnormal y1Tg + MO1-sox32 standard conditions Fig. S4 from Chung et al., 2011
blood circulation decreased rate, abnormal y1Tg + MO1-sox32 standard conditions Fig. 2 with image from Leslie et al., 2007
vasculature development disrupted, abnormal y1Tg + MO1-sox32 standard conditions Fig. S4 from Chung et al., 2011
axial vasculature morphology, abnormal y1Tg + MO1-sox32 standard conditions Fig. S4 from Chung et al., 2011
facial placode poorly differentiated, abnormal AB + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
vagal placode 3 poorly differentiated, abnormal AB + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
ectodermal placode development decreased process quality, abnormal AB + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
vagal placode 1 poorly differentiated, abnormal AB + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
glossopharyngeal placode poorly differentiated, abnormal AB + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
vagal placode 4 poorly differentiated, abnormal AB + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
vagal placode 2 poorly differentiated, abnormal AB + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
head lacks all parts of type facial ganglion, abnormal w37Tg + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
head lacks all parts of type glossopharyngeal ganglion, abnormal w37Tg + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
cranial ganglion maturation decreased process quality, abnormal w37Tg + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
head lacks all parts of type vagal ganglion 1, abnormal w37Tg + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
head lacks all parts of type vagal ganglion 2, abnormal w37Tg + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
head lacks all parts of type vagal ganglion 4, abnormal w37Tg + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
head lacks all parts of type vagal ganglion 3, abnormal w37Tg + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
Citations