Morpholino
MO3-fgf8a
- ID
- ZDB-MRPHLNO-050714-1
- Name
- MO3-fgf8a
- Previous Names
- Target
- Sequence
-
5' - GAGTCTCATGTTTATAGCCTCAGTA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-fgf8a
No data available
Phenotype
Phenotype resulting from MO3-fgf8a
1 - 5 of 16 Show all
Phenotype of all Fish created by or utilizing MO3-fgf8a
1 - 5 of 39 Show all
Citations
- Klingbeil, K., Nguyen, T., Fahrner, A., Guthmann, C., Wang, H., Schoels, M., Lilienkamp, M., Franz, H., Eckert, P., Walz, G., Yakulov, T.A. (2021) Corpuscles of Stannius development requires FGF signaling. Developmental Biology. 481:160-171
- Osborn, D.P.S., Li, K., Cutty, S.J., Nelson, A.C., Wardle, F.C., Hinits, Y., Hughes, S.M. (2020) Fgf-driven Tbx protein activities directly induce myf5 and myod to initiate zebrafish myogenesis. Development (Cambridge, England). 147(8):
- Cao, M., Ouyang, J., Guo, J., Lin, S., Chen, S. (2018) Metalloproteinase Adamts16 Is Required for Proper Closure of the Optic Fissure. Investigative ophthalmology & visual science. 59:1167-1177
- Felker, A., Prummel, K.D., Merks, A.M., Mickoleit, M., Brombacher, E.C., Huisken, J., Panáková, D., Mosimann, C. (2018) Continuous addition of progenitors forms the cardiac ventricle in zebrafish. Nature communications. 9:2001
- Li, J., Yue, Y., Dong, X., Jia, W., Li, K., Liang, D., Dong, Z., Wang, X., Nan, X., Zhang, Q., Zhao, Q. (2015) Zebrafish foxc1a plays a crucial role in early somitogenesis by restricting the expression of aldh1a2 directly. The Journal of biological chemistry. 290(16):10216-28
- Long, L., Guo, H., Yao, D., Xiong, K., Li, Y., Liu, P., Zhu, Z., Liu, D. (2015) Regulation of transcriptionally active genes via the catalytically inactive Cas9 in C. elegans and D. rerio. Cell Research. 25:638-41
- van Boxtel, A.L., Chesebro, J.E., Heliot, C., Ramel, M.C., Stone, R.K., Hill, C.S. (2015) A Temporal Window for Signal Activation Dictates the Dimensions of a Nodal Signaling Domain. Developmental Cell. 35:175-185
- Wang, J., Wu, Y., Zhao, F., Wu, Y., Dong, W., Zhao, J., Zhu, Z., Liu, D. (2015) Fgf-signaling-dependent sox9a and atoh1a regulate otic neural development in zebrafish. The Journal of neuroscience : the official journal of the Society for Neuroscience. 35:234-44
- Miyake, A., Chitose, T., Kamei, E., Murakami, A., Nakayama, Y., Konishi, M., Itoh, N. (2014) Fgf16 Is Required for Specification of GABAergic Neurons and Oligodendrocytes in the Zebrafish Forebrain. PLoS One. 9:e110836
- Retnoaji, B., Akiyama, R., Matta, T., Bessho, Y., and Matsui, T. (2014) Retinoic acid controls proper head-to-trunk linkage in zebrafish by regulating an anteroposterior somitogenetic rate difference. Development (Cambridge, England). 141(1):158-165
1 - 10 of 48
Show