Morpholino
MO1-per2
- ID
- ZDB-MRPHLNO-050708-2
- Name
- MO1-per2
- Previous Names
- Target
- Sequence
-
5' - GGTCTTCAGACATCGGACTTGGGTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation blocking morpholino spanning the translation start site of the gene per2.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-per2
No data available
Phenotype
Phenotype resulting from MO1-per2
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO1-per2
1 - 5 of 10 Show all
Citations
- Jensen, L.D., Cao, Z., Nakamura, M., Yang, Y., Bräutigam, L., Andersson, P., Zhang, Y., Wahlberg, E., Länne, T., Hosaka, K., and Cao, Y. (2012) Opposing Effects of Circadian Clock Genes Bmal1 and Period2 in Regulation of VEGF-Dependent Angiogenesis in Developing Zebrafish. Cell Reports. 2(2):231-241
- Dekens, M.P., and Whitmore, D. (2008) Autonomous onset of the circadian clock in the zebrafish embryo. The EMBO journal. 27(20):2757-2765
- Ziv, L., and Gothilf, Y. (2006) Circadian time-keeping during early stages of development. Proceedings of the National Academy of Sciences of the United States of America. 103(11):4146-4151
- Ziv, L., Levkovitz, S., Toyama, R., Falcon, J., and Gothilf, Y. (2005) Functional Development of the Zebrafish Pineal Gland: Light-Induced Expression of Period2 is Required for Onset of the Circadian Clock. Journal of neuroendocrinology. 17(5):314-320
1 - 4 of 4
Show