Morpholino
MO2-dlc
- ID
- ZDB-MRPHLNO-050531-2
- Name
- MO2-dlc
- Previous Names
-
- deltaCmo2 (1)
- Target
- Sequence
-
5' - CGATAGCAGACTGTGAGAGTAGTCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-dlc
No data available
Phenotype
Phenotype resulting from MO2-dlc
No data available
Phenotype of all Fish created by or utilizing MO2-dlc
1 - 3 of 3
Citations
- Lu, Y.F., Liu, D.W., Li, I.C., Lin, J., Wang, C.M., Chu, K.C., Kuo, H.H., Lin, C.Y., Yih, L.H., Jiang, Y.J., Hwang, S.L. (2021) Delta/Jagged-mediated Notch signaling induces the differentiation of agr2-positive epidermal mucous cells in zebrafish embryos. PLoS Genetics. 17:e1009969
- Campbell, L.J., Hobgood, J.S., Jia, M., Boyd, P., Hipp, R.I., Hyde, D.R. (2020) Notch3 and DeltaB maintain Müller glia quiescence and act as negative regulators of regeneration in the light-damaged zebrafish retina. Glia. 69(3):546-566
- Nerli, E., Rocha-Martins, M., Norden, C. (2020) Asymmetric neurogenic commitment of retinal progenitors involves Notch through the endocytic pathway. eLIFE. 9:
- Okigawa, S., Mizoguchi, T., Okano, M., Tanaka, H., Isoda, M., Jiang, Y.J., Suster, M., Higashijima, S.I., Kawakami, K., Itoh, M. (2014) Different combinations of Notch ligands and receptors regulate V2 interneuron progenitor proliferation and V2a/V2b cell fate determination. Developmental Biology. 391(2):196-206
- Quillien, A., Moore, J.C., Shin, M., Siekmann, A.F., Smith, T., Pan, L., Moens, C.B., Parsons, M.J., Lawson, N.D. (2014) Distinct Notch signaling outputs pattern the developing arterial system. Development (Cambridge, England). 141:1544-52
- Mara, A., Schroeder, J., and Holley, S.A. (2008) Two deltaC splice-variants have distinct signaling abilities during somitogenesis and midline patterning. Developmental Biology. 318(1):126-132
- Holley, S.A., Jülich, D., Rauch, G.J., Geisler, R., and Nüsslein-Volhard, C. (2002) her1 and the notch pathway function within the oscillator mechanism that regulates zebrafish somitogenesis. Development (Cambridge, England). 129(5):1175-1183
1 - 7 of 7
Show