Morpholino

MO2-gli2a

ID

ZDB-MRPHLNO-050308-4

Name

MO2-gli2a

Previous Names

gli2 MO (1)
MO2-gli2 (1)

Target

gli2a (1)

Sequence

5' - GAGGTGGGACTTGTGGTCTCCATGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This is a translation blocking morpholino that targets gli2a.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-gli2a

Expressed Gene	Anatomy	Figures
neurod4	hindbrain	Fig. 2 from Ke et al., 2008
prdm1a	adaxial cell	Fig. 4 from Lobbardi et al., 2011
ptch2	adaxial cell	Fig. 4 from Lobbardi et al., 2011

Phenotype

Phenotype resulting from MO2-gli2a

Phenotype	Fish	Figures
adaxial cell physical object quality, abnormal	WT + MO2-gli2a	Fig. 4 from Lobbardi et al., 2011
fast muscle cell increased amount, abnormal	WT + MO2-gli2a	Fig. 5 from Wolff et al., 2003
horizontal myoseptum morphology, abnormal	WT + MO2-gli2a	Fig. S1 from Ke et al., 2008
muscle pioneer mislocalised, abnormal	WT + MO2-gli2a	Fig. 5 from Wolff et al., 2003
myotome malformed, abnormal	WT + MO2-gli2a	Fig. 4 from Lobbardi et al., 2011
skeletal muscle tissue development process quality, abnormal	WT + MO2-gli2a	Fig. 4 from Lobbardi et al., 2011
slow muscle cell mislocalised, abnormal	WT + MO2-gli2a	Fig. 4 from Lobbardi et al., 2011
smoothened signaling pathway process quality, abnormal	WT + MO2-gli2a	Fig. 4 from Lobbardi et al., 2011
somite U-shaped, abnormal	WT + MO2-gli2a	Fig. 5 from Wolff et al., 2003

Phenotype of all Fish created by or utilizing MO2-gli2a

Phenotype	Fish	Conditions	Figures
muscle pioneer mislocalised, abnormal	gli2a^ty119/ty119 + MO2-gli2a	standard conditions	Fig. 5 from Wolff et al., 2003
myotome malformed, abnormal	WT + MO2-gli2a	standard conditions	Fig. 4 from Lobbardi et al., 2011
slow muscle cell mislocalised, abnormal	WT + MO2-gli2a	standard conditions	Fig. 4 from Lobbardi et al., 2011
adaxial cell physical object quality, abnormal	WT + MO2-gli2a	standard conditions	Fig. 4 from Lobbardi et al., 2011
skeletal muscle tissue development process quality, abnormal	WT + MO2-gli2a	standard conditions	Fig. 4 from Lobbardi et al., 2011
somite U-shaped, abnormal	WT + MO2-gli2a	standard conditions	Fig. 5 from Wolff et al., 2003
smoothened signaling pathway process quality, abnormal	WT + MO2-gli2a	standard conditions	Fig. 4 from Lobbardi et al., 2011
horizontal myoseptum morphology, abnormal	WT + MO2-gli2a	standard conditions	Fig. S1 from Ke et al., 2008
muscle pioneer mislocalised, abnormal	WT + MO2-gli2a	standard conditions	Fig. 5 from Wolff et al., 2003
fast muscle cell increased amount, abnormal	WT + MO2-gli2a	standard conditions	Fig. 5 from Wolff et al., 2003
slow muscle cell decreased amount, abnormal	gli1^ts269/ts269 + MO2-gli2a	standard conditions	Fig. 5 from Wolff et al., 2003
fast muscle cell absent, abnormal	gli1^ts269/ts269 + MO2-gli2a	standard conditions	Fig. 5 from Wolff et al., 2003
muscle pioneer absent, abnormal	gli1^ts269/ts269 + MO2-gli2a	standard conditions	Fig. 5 from Wolff et al., 2003
fast muscle cell increased amount, abnormal	WT + MO1-stk36 + MO2-gli2a	standard conditions	Fig. 6 from Wolff et al., 2003
muscle pioneer absent, abnormal	WT + MO1-stk36 + MO2-gli2a	standard conditions	Fig. 6 from Wolff et al., 2003
muscle pioneer mislocalised, abnormal	WT + MO1-sufu + MO2-gli2a	standard conditions	Fig. 7 from Wolff et al., 2003
fast muscle cell increased amount, abnormal	WT + MO1-sufu + MO2-gli2a	standard conditions	Fig. 7 from Wolff et al., 2003

Citations