Morpholino

MO1-tcf7l1b

ID
ZDB-MRPHLNO-050308-11
Name
MO1-tcf7l1b
Previous Names
  • MO2-tcf7l1b
  • tcf3b-MO (1)
Target
Sequence
5' - CGCCTCCGTTAAGCTGCGGCATGTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tcf7l1b
No data available
Phenotype
Phenotype resulting from MO1-tcf7l1b
Phenotype Fish Figures
atrium has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 Fig. 1 with image from Sorrell et al., 2013
axon guidance disrupted, abnormal AB + MO1-tcf7l1b Fig. 3 with image from Riley et al., 2004
brain decreased size, abnormal WT + MO1-tcf7l1b Fig. 3 from Dorsky et al., 2003
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 Fig. 1 with image from Sorrell et al., 2013
cell proliferation in hindbrain disrupted, abnormal WT + MO1-tcf7l1b Fig. 4 with image from Amoyel et al., 2005
embryonic pattern specification disrupted, abnormal AB + MO1-tcf7l1b Fig. 3 with image from Riley et al., 2004
heart has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 Fig. 1 with image from Sorrell et al., 2013
heart increased size, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 Fig. 1 with image from Sorrell et al., 2013
heart linear, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 Fig. 1 with image from Sorrell et al., 2013
hindbrain constricted, abnormal AB + MO1-tcf7l1b Fig. 3 with image from Riley et al., 2004
hindbrain decreased width, abnormal WT + MO1-tcf7l1b Fig. 4 with image from Amoyel et al., 2005
hindbrain morphology, abnormal AB + MO1-tcf7l1b Fig. 3 with image from Riley et al., 2004
hindbrain commissure neuron absent, abnormal AB + MO1-tcf7l1b Fig. 3 with image from Riley et al., 2004
hindbrain morphogenesis delayed, abnormal WT + MO1-tcf7l1b Fig. 4 with image from Amoyel et al., 2005
Mauthner neuron axon decreased length, abnormal AB + MO1-tcf7l1b Fig. 3 with image from Riley et al., 2004
Mauthner neuron axon fasciculation, abnormal AB + MO1-tcf7l1b Fig. 3 with image from Riley et al., 2004
midbrain hindbrain boundary closure incomplete, abnormal WT + MO1-tcf7l1b Fig. 6 from Dorsky et al., 2003
neurogenesis disrupted, abnormal WT + MO1-tcf7l1b Fig. 4 with image from Amoyel et al., 2005
pericardium edematous, abnormal WT + MO1-tcf7l1b Fig. 3 from Dorsky et al., 2003
radial glial cell cell projection irregular spatial pattern, abnormal AB + MO1-tcf7l1b Fig. 3 with image from Riley et al., 2004
rhombomere morphology, abnormal WT + MO1-tcf7l1b Fig. 6 from Dorsky et al., 2003
rhombomere primary neuron crowded, abnormal AB + MO1-tcf7l1b Fig. 3 with image from Riley et al., 2004
rhombomere primary neuron disorganized, abnormal AB + MO1-tcf7l1b Fig. 3 with image from Riley et al., 2004
rhombomere morphogenesis disrupted, abnormal WT + MO1-tcf7l1b Fig. 6 from Dorsky et al., 2003
Phenotype of all Fish created by or utilizing MO1-tcf7l1b
Phenotype Fish Conditions Figures
hindbrain commissure neuron absent, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
rhombomere primary neuron disorganized, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
Mauthner neuron axon decreased length, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
rhombomere primary neuron crowded, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
radial glial cell cell projection irregular spatial pattern, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
embryonic pattern specification disrupted, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
hindbrain constricted, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
axon guidance disrupted, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
hindbrain morphology, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
Mauthner neuron axon fasciculation, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
pericardium edematous, abnormal WT + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
cell proliferation in hindbrain disrupted, abnormal WT + MO1-tcf7l1b standard conditions Fig. 4 with image from Amoyel et al., 2005
midbrain hindbrain boundary closure incomplete, abnormal WT + MO1-tcf7l1b standard conditions Fig. 6 from Dorsky et al., 2003
hindbrain decreased width, abnormal WT + MO1-tcf7l1b standard conditions Fig. 4 with image from Amoyel et al., 2005
rhombomere morphology, abnormal WT + MO1-tcf7l1b standard conditions Fig. 6 from Dorsky et al., 2003
rhombomere morphogenesis disrupted, abnormal WT + MO1-tcf7l1b standard conditions Fig. 6 from Dorsky et al., 2003
neurogenesis disrupted, abnormal WT + MO1-tcf7l1b standard conditions Fig. 4 with image from Amoyel et al., 2005
hindbrain morphogenesis delayed, abnormal WT + MO1-tcf7l1b standard conditions Fig. 4 with image from Amoyel et al., 2005
brain decreased size, abnormal WT + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
heart increased size, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart linear, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
atrium has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
brain wholly posteriorized, abnormal tcf7l1am881/m881 + MO1-tcf7l1b standard conditions Fig. 4 from Dorsky et al., 2003
head morphology, abnormal tcf7l1am881/m881 + MO1-tcf7l1b standard conditions Fig. 5 from Ro et al., 2011
forebrain morphology, abnormal tcf7l1am881/m881 + MO1-tcf7l1b standard conditions Fig. 4 from Dorsky et al., 2003
rostrocaudal neural tube patterning disrupted, abnormal tcf7l1am881/m881 + MO1-tcf7l1b standard conditions Fig. 4 from Dorsky et al., 2003
head development abnormal, abnormal tcf7l1am881/m881 + MO1-tcf7l1b standard conditions Fig. 5 from Ro et al., 2011
head decreased size, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
brain decreased size, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
telencephalon aplastic, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
eye aplastic, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
midbrain increased size, abnormal WT + MO1-tcf7l1b + MO2-tcf7l1a standard conditions Fig. S4 with image from Nyholm et al., 2007
midbrain decreased size, abnormal WT + MO1-tcf7l1b + MO2-tcf7l1a standard conditions Fig. 6 with image from Nyholm et al., 2007
forebrain wholly posteriorized, abnormal WT + MO1-tcf7l1b + MO2-tcf7l1a standard conditions Fig. 6 with image from Nyholm et al., 2007
head morphology, abnormal tcf7l1am881/m881 + MO1-e4f1 + MO1-tcf7l1b standard conditions Fig. 5 from Ro et al., 2011
head development abnormal, abnormal tcf7l1am881/m881 + MO1-e4f1 + MO1-tcf7l1b standard conditions Fig. 5 from Ro et al., 2011
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
atrium has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart increased size, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart linear, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
cranial vasculature anterior region absent, abnormal s843Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 9 with image from Sorrell et al., 2013
Citations