Morpholino

MO1-tcf7l1b

ID
ZDB-MRPHLNO-050308-11
Name
MO1-tcf7l1b
Previous Names
  • MO2-tcf7l1b
  • tcf3b-MO (1)
Target
Sequence
5' - CGCCTCCGTTAAGCTGCGGCATGTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tcf7l1b
Expressed Gene Anatomy Figures
ascl1b Fig. 4 with image from Amoyel et al., 2005
cdx4 Fig. 4 from Ro et al., 2011
dla Fig. 4 with image from Amoyel et al., 2005
Fig. 3 with image from Riley et al., 2004
epha4a Fig. 3 with image from Riley et al., 2004
etv5b Fig. 3 with image from Riley et al., 2004
foxb1a Fig. 2 with image from Amoyel et al., 2005
neurog1 Fig. 4 with image from Amoyel et al., 2005
rfng Fig. 2 with image from Amoyel et al., 2005
wnt1 Fig. 3 with image from Riley et al., 2004
Phenotype
Phenotype resulting from MO1-tcf7l1b
Phenotype Fish Figures
atrium has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 Fig. 1 with image from Sorrell et al., 2013
axon guidance disrupted, abnormal AB + MO1-tcf7l1b Fig. 3 with image from Riley et al., 2004
brain decreased size, abnormal WT + MO1-tcf7l1b Fig. 3 from Dorsky et al., 2003
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 Fig. 1 with image from Sorrell et al., 2013
cell proliferation in hindbrain disrupted, abnormal WT + MO1-tcf7l1b Fig. 4 with image from Amoyel et al., 2005
embryonic pattern specification disrupted, abnormal AB + MO1-tcf7l1b Fig. 3 with image from Riley et al., 2004
heart has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 Fig. 1 with image from Sorrell et al., 2013
heart increased size, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 Fig. 1 with image from Sorrell et al., 2013
heart linear, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 Fig. 1 with image from Sorrell et al., 2013
hindbrain constricted, abnormal AB + MO1-tcf7l1b Fig. 3 with image from Riley et al., 2004
hindbrain decreased width, abnormal WT + MO1-tcf7l1b Fig. 4 with image from Amoyel et al., 2005
hindbrain morphology, abnormal AB + MO1-tcf7l1b Fig. 3 with image from Riley et al., 2004
hindbrain commissure neuron absent, abnormal AB + MO1-tcf7l1b Fig. 3 with image from Riley et al., 2004
hindbrain morphogenesis delayed, abnormal WT + MO1-tcf7l1b Fig. 4 with image from Amoyel et al., 2005
Mauthner neuron axon decreased length, abnormal AB + MO1-tcf7l1b Fig. 3 with image from Riley et al., 2004
Mauthner neuron axon fasciculation, abnormal AB + MO1-tcf7l1b Fig. 3 with image from Riley et al., 2004
midbrain hindbrain boundary closure incomplete, abnormal WT + MO1-tcf7l1b Fig. 6 from Dorsky et al., 2003
neurogenesis disrupted, abnormal WT + MO1-tcf7l1b Fig. 4 with image from Amoyel et al., 2005
pericardium edematous, abnormal WT + MO1-tcf7l1b Fig. 3 from Dorsky et al., 2003
radial glial cell cell projection irregular spatial pattern, abnormal AB + MO1-tcf7l1b Fig. 3 with image from Riley et al., 2004
rhombomere morphology, abnormal WT + MO1-tcf7l1b Fig. 6 from Dorsky et al., 2003
rhombomere primary neuron crowded, abnormal AB + MO1-tcf7l1b Fig. 3 with image from Riley et al., 2004
rhombomere primary neuron disorganized, abnormal AB + MO1-tcf7l1b Fig. 3 with image from Riley et al., 2004
rhombomere morphogenesis disrupted, abnormal WT + MO1-tcf7l1b Fig. 6 from Dorsky et al., 2003
Phenotype of all Fish created by or utilizing MO1-tcf7l1b
Phenotype Fish Conditions Figures
hindbrain commissure neuron absent, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
rhombomere primary neuron disorganized, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
Mauthner neuron axon decreased length, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
rhombomere primary neuron crowded, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
radial glial cell cell projection irregular spatial pattern, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
embryonic pattern specification disrupted, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
hindbrain constricted, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
axon guidance disrupted, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
hindbrain morphology, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
Mauthner neuron axon fasciculation, abnormal AB + MO1-tcf7l1b standard conditions Fig. 3 with image from Riley et al., 2004
pericardium edematous, abnormal WT + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
cell proliferation in hindbrain disrupted, abnormal WT + MO1-tcf7l1b standard conditions Fig. 4 with image from Amoyel et al., 2005
midbrain hindbrain boundary closure incomplete, abnormal WT + MO1-tcf7l1b standard conditions Fig. 6 from Dorsky et al., 2003
hindbrain decreased width, abnormal WT + MO1-tcf7l1b standard conditions Fig. 4 with image from Amoyel et al., 2005
rhombomere morphology, abnormal WT + MO1-tcf7l1b standard conditions Fig. 6 from Dorsky et al., 2003
rhombomere morphogenesis disrupted, abnormal WT + MO1-tcf7l1b standard conditions Fig. 6 from Dorsky et al., 2003
neurogenesis disrupted, abnormal WT + MO1-tcf7l1b standard conditions Fig. 4 with image from Amoyel et al., 2005
hindbrain morphogenesis delayed, abnormal WT + MO1-tcf7l1b standard conditions Fig. 4 with image from Amoyel et al., 2005
brain decreased size, abnormal WT + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
heart increased size, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart linear, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
atrium has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
brain wholly posteriorized, abnormal tcf7l1am881/m881 + MO1-tcf7l1b standard conditions Fig. 4 from Dorsky et al., 2003
head morphology, abnormal tcf7l1am881/m881 + MO1-tcf7l1b standard conditions Fig. 5 from Ro et al., 2011
forebrain morphology, abnormal tcf7l1am881/m881 + MO1-tcf7l1b standard conditions Fig. 4 from Dorsky et al., 2003
rostrocaudal neural tube patterning disrupted, abnormal tcf7l1am881/m881 + MO1-tcf7l1b standard conditions Fig. 4 from Dorsky et al., 2003
head development abnormal, abnormal tcf7l1am881/m881 + MO1-tcf7l1b standard conditions Fig. 5 from Ro et al., 2011
head decreased size, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
brain decreased size, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
telencephalon aplastic, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
eye aplastic, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
midbrain increased size, abnormal WT + MO1-tcf7l1b + MO2-tcf7l1a standard conditions Fig. S4 with image from Nyholm et al., 2007
midbrain decreased size, abnormal WT + MO1-tcf7l1b + MO2-tcf7l1a standard conditions Fig. 6 with image from Nyholm et al., 2007
forebrain wholly posteriorized, abnormal WT + MO1-tcf7l1b + MO2-tcf7l1a standard conditions Fig. 6 with image from Nyholm et al., 2007
head morphology, abnormal tcf7l1am881/m881 + MO1-e4f1 + MO1-tcf7l1b standard conditions Fig. 5 from Ro et al., 2011
head development abnormal, abnormal tcf7l1am881/m881 + MO1-e4f1 + MO1-tcf7l1b standard conditions Fig. 5 from Ro et al., 2011
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
atrium has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart increased size, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart linear, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
cranial vasculature anterior region absent, abnormal s843Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 9 with image from Sorrell et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.