Morpholino
MO4-neurog1
- ID
- ZDB-MRPHLNO-050301-2
- Name
- MO4-neurog1
- Previous Names
-
- ngn1 MO (1)
- Target
- Sequence
-
5' - TATACGATCTCCATTGTTGATAACC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-neurog1
No data available
Phenotype
Phenotype resulting from MO4-neurog1
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO4-neurog1
1 - 5 of 9 Show all
Citations
- Dyer, C., Linker, C., Graham, A., Knight, R. (2014) Specification of sensory neurons occurs through diverse developmental programs functioning in the brain and spinal cord. Developmental Dynamics : an official publication of the American Association of Anatomists. 243(11):1429-39
- Hans, S., Irmscher, A., and Brand, M. (2013) Zebrafish Foxi1 provides a neuronal ground state during inner ear induction preceding the Dlx3b/4b-regulated sensory lineage. Development (Cambridge, England). 140(9):1936-1945
- Yoshizawa, A., Nakahara, Y., Izawa, T., Ishitani, T., Tsutsumi, M., Kuroiwa, A., Itoh, M., and Kikuchi, Y. (2011) Zebrafish Dmrta2 regulates neurogenesis in the telencephalon. Genes to cells : devoted to molecular & cellular mechanisms. 16(11):1097-1109
- Sarrazin, A.F., Nuñez, V.A., Sapède, D., Tassin, V., Dambly-Chaudière, C., and Ghysen, A. (2010) Origin and early development of the posterior lateral line system of zebrafish. The Journal of neuroscience : the official journal of the Society for Neuroscience. 30(24):8234-8244
- Scholpp, S., Delogu, A., Gilthorpe, J., Peukert, D., Schindler, S., and Lumsden, A. (2009) Her6 regulates the neurogenetic gradient and neuronal identity in the thalamus. Proceedings of the National Academy of Sciences of the United States of America. 106(47):19895-19900
- Hernandez, P.P., Olivari, F.A., Sarrazin, A.F., Sandoval, P.C., and Allende, M.L. (2007) Regeneration in zebrafish lateral line neuromasts: Expression of the neural progenitor cell marker sox2 and proliferation-dependent and-independent mechanisms of hair cell renewal. Developmental Neurobiology. 67(5):637-654
- Li, W., and Cornell, R.A. (2007) Redundant activities of Tfap2a and Tfap2c are required for neural crest induction and development of other non-neural ectoderm derivatives in zebrafish embryos. Developmental Biology. 304(1):338-354
- Bricaud, O., and Collazo, A. (2006) The transcription factor six1 inhibits neuronal and promotes hair cell fate in the developing zebrafish (Danio rerio) inner ear. The Journal of neuroscience : the official journal of the Society for Neuroscience. 26(41):10438-10451
- Sarrazin, A.F., Villablanca, E.J., Nunez, V.A., Sandoval, P.C., Ghysen, A., and Allende, M.L. (2006) Proneural gene requirement for hair cell differentiation in the zebrafish lateral line. Developmental Biology. 295(2):534-545
- Bae, Y.K., Shimizu, T., and Hibi, M. (2005) Patterning of proneuronal and inter-proneuronal domains by hairy- and enhancer of split-related genes in zebrafish neuroectoderm. Development (Cambridge, England). 132(6):1375-1385
1 - 10 of 12
Show