Morpholino
MO1-clocka
- ID
- ZDB-MRPHLNO-050119-1
- Name
- MO1-clocka
- Previous Names
-
- clock MO
- Target
- Sequence
-
5' - CATCCCGGTCTATGCTGGAGGTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-clocka
No data available
Phenotype
Phenotype resulting from MO1-clocka
1 - 5 of 37 Show all
Phenotype of all Fish created by or utilizing MO1-clocka
1 - 5 of 38 Show all
Citations
- Bian, S.S., Zheng, X.L., Sun, H.Q., Chen, J.H., Lu, Y.L., Liu, Y.Q., Tao, D.C., Ma, Y.X. (2017) Clock1a affects mesoderm development and primitive hematopoiesis by regulating Nodal-Smad3 signalings in the zebrafish embryo. The Journal of biological chemistry. 292(34):14165-14175
- Li, Y., Li, G., Görling, B., Luy, B., Du, J., Yan, J. (2015) Integrative Analysis of Circadian Transcriptome and Metabolic Network Reveals the Role of De Novo Purine Synthesis in Circadian Control of Cell Cycle. PLoS Computational Biology. 11:e1004086
- Li, Y., Li, G., Wang, H., Du, J., and Yan, J. (2013) Analysis of a gene regulatory cascade mediating circadian rhythm in zebrafish. PLoS Computational Biology. 9(2):e1002940
- Li, P., Chaurasia, S.S., Gao, Y., Carr, A.L., Iuvone, P.M., and Li, L. (2008) CLOCK is required for maintaining the circadian rhythms of opsin mRNA expression in photoreceptor cells. The Journal of biological chemistry. 283(46):31673-31678
- Triqueneaux, G., Thenot, S., Kakizawa, T., Antoch, M.P., Safi, R., Takahashi, J.S., Delaunay, F., and Laudet, V. (2004) The orphan receptor Rev-erb{alpha} gene is a target of the circadian clock pacemaker. Journal of molecular endocrinology. 33(3):585-608
1 - 5 of 5
Show