Morpholino
MO1-trpa1b
- ID
- ZDB-MRPHLNO-050106-4
- Name
- MO1-trpa1b
- Previous Names
- Target
- Sequence
-
5' - TCACTAACTCCTTTCCAAACTGCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
A trpa1l translation blocking morpholino
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-trpa1b
No data available
Phenotype
Phenotype resulting from MO1-trpa1b
| Phenotype | Fish | Figures |
|---|---|---|
| chemosensory behavior decreased occurrence, abnormal | WT + MO1-trpa1b |
Fig. 2
from Faucherre et al., 2013 |
Phenotype of all Fish created by or utilizing MO1-trpa1b
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| chemosensory behavior decreased occurrence, abnormal | WT + MO1-trpa1b | standard conditions |
Fig. 2
from Faucherre et al., 2013 |
Citations