Morpholino
MO1-wnt5b
- ID
- ZDB-MRPHLNO-041217-11
- Name
- MO1-wnt5b
- Previous Names
- Target
- Sequence
-
5' - GTCCTTGGTTCATTCTCACATCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wnt5b
No data available
Phenotype
Phenotype resulting from MO1-wnt5b
1 - 5 of 56 Show all
Phenotype of all Fish created by or utilizing MO1-wnt5b
1 - 5 of 88 Show all
Citations
- Saraswathy, V.M., Kurup, A.J., Sharma, P., Polès, S., Poulain, M., Fürthauer, M. (2022) The E3 Ubiquitin Ligase Mindbomb1 controls planar cell polarity-dependent convergent extension movements during zebrafish gastrulation. eLIFE. 11:
- Castanon, I., Hannich, J.T., Abrami, L., Huber, F., Dubois, M., Müller, M., van der Goot, F.G., Gonzalez-Gaitan, M. (2020) Wnt-controlled sphingolipids modulate Anthrax Toxin Receptor palmitoylation to regulate oriented mitosis in zebrafish. Nature communications. 11:3317
- Hung, I.C., Chen, T.M., Lin, J.P., Tai, Y.L., Shen, T.L., Lee, S.J. (2020) Wnt5b integrates Fak1a to mediate gastrulation cell movements via Rac1 and Cdc42. Open Biology. 10:190273
- Zhang, J., Chandrasekaran, G., Li, W., Kim, D.Y., Jeong, I.Y., Lee, S.H., Liang, T., Bae, J.Y., Choi, I., Kang, H., Maeng, J.S., Kim, M.K., Lee, T., Park, S.W., Kim, M.J., Kim, H.S., Ro, H., Bae, Y.C., Park, H.C., Choi, E.Y., Choi, S.Y. (2020) Wnt-PLC-IP3-Connexin-Ca2+ axis maintains ependymal motile cilia in zebrafish spinal cord. Nature communications. 11:1860
- Gong, B., Shen, W., Xiao, W., Meng, Y., Meng, A., Jia, S. (2017) The Sec14-like phosphatidylinositol transfer proteins Sec14l3/SEC14L2 act as GTPase proteins to mediate Wnt/Ca2+ signaling.. eLIFE. 6
- Nicenboim, J., Malkinson, G., Lupo, T., Asaf, L., Sela, Y., Mayseless, O., Gibbs-Bar, L., Senderovich, N., Hashimshony, T., Shin, M., Jerafi-Vider, A., Avraham-Davidi, I., Krupalnik, V., Hofi, R., Almog, G., Astin, J.W., Golani, O., Ben-Dor, S., Crosier, P.S., Herzog, W., Lawson, N.D., Hanna, J.H., Yanai, I., Yaniv, K. (2015) Lymphatic vessels arise from specialized angioblasts within a venous niche. Nature. 522(7554):56-61
- Young, T., Poobalan, Y., Tan, E.K., Tao, S., Ong, S., Wehner, P., Schwenty-Lara, J., Lim, C.Y., Sadasivam, A., Lovatt, M., Wang, S.T., Ali, Y., Borchers, A., Sampath, K., Dunn, N.R. (2014) The PDZ domain protein Mcc is a novel effector of non-canonical Wnt signaling during convergence and extension in zebrafish. Development (Cambridge, England). 141:3505-16
- Castanon, I., Abrami, L., Holtzer, L., Heisenberg, C.P., van der Goot, F.G., and González-Gaitán, M. (2013) Anthrax toxin receptor 2a controls mitotic spindle positioning. Nature cell biology. 15(1):28-39
- Chen, Q., Takada, R., and Takada, S. (2012) Loss of Porcupine impairs convergent extension during gastrulation in zebrafish. Journal of Cell Science. 125(9):2224-2234
- Lou, Q., He, J., Hu, L., and Yin, Z. (2012) Role of lbx2 in the noncanonical Wnt signaling pathway for convergence and extension movements and hypaxial myogenesis in zebrafish. Biochimica et biophysica acta. Molecular cell research. 1823(5):1024-1032
1 - 10 of 25
Show