Morpholino

MO1-fgf3

ID
ZDB-MRPHLNO-041109-4
Name
MO1-fgf3
Previous Names
  • fgf3-MO #1
  • fgf3A-MO
Target
Sequence
5' - CATTGTGGCATGGCGGGATGTCGGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fgf3
No data available
Phenotype
Phenotype resulting from MO1-fgf3
Phenotype of all Fish created by or utilizing MO1-fgf3
Phenotype Fish Conditions Figures
pharyngeal arch 4 has fewer parts of type cranial neural crest, abnormal AB + MO1-fgf3 standard conditions Fig. 3 from Lin et al., 2013
pharyngeal arch 3-7 skeleton absent, abnormal AB + MO1-fgf3 standard conditions Fig. 3 from Lin et al., 2013
ceratobranchial cartilage absent, abnormal AB + MO1-fgf3 standard conditions Fig. 3 from Lin et al., 2013
ceratohyal cartilage malformed, abnormal AB + MO1-fgf3 standard conditions Fig. 3 from Lin et al., 2013
epibranchial field sox3 expression decreased amount, abnormal WT + MO1-fgf3 standard conditions Fig. 5 with image from Sun et al., 2007
ceratohyal cartilage aplastic, abnormal WT + MO1-fgf3 standard conditions Fig. 4 from Hanaoka et al., 2004
epibranchial field pax2a expression decreased amount, abnormal WT + MO1-fgf3 standard conditions Fig. 5 with image from Sun et al., 2007
basibranchial aplastic, abnormal WT + MO1-fgf3 standard conditions Fig. 4 from Hanaoka et al., 2004
hyosymplectic cartilage hypoplastic, abnormal WT + MO1-fgf3 standard conditions Fig. 8 with image from Nissen et al., 2003
otic vesicle decreased size, abnormal WT + MO1-fgf3 + MO2-fgf3 standard conditions Fig. 4 with image from Mackereth et al., 2005
otic vesicle morphogenesis process quality, abnormal WT + MO1-fgf3 + MO2-fgf3 standard conditions Fig. 4 with image from Mackereth et al., 2005
adenohypophysis morphogenesis process quality, abnormal zf44Tg + MO1-fgf3 standard conditions Fig. 2 with imageFig. 3 with imageFig. 5 with image from Liu et al., 2008
pars intermedia physical object quality, abnormal zf44Tg + MO1-fgf3 standard conditions Fig. 2 with imageFig. 3 with imageFig. 5 with image from Liu et al., 2008
adenohypophysis morphogenesis process quality, abnormal zf113Tg; zf44Tg + MO1-fgf3 standard conditions Fig. 4 with image from Liu et al., 2008
pars intermedia physical object quality, abnormal zf113Tg; zf44Tg + MO1-fgf3 standard conditions Fig. 4 with image from Liu et al., 2008
epibranchial field pax2a expression absent, abnormal fgf8ati282a/ti282a + MO1-fgf3 standard conditions Fig. 5 with image from Sun et al., 2007
midbrain hindbrain boundary neural rod pax2a expression absent, abnormal fgf8ati282a/ti282a + MO1-fgf3 standard conditions Fig. 5 with image from Sun et al., 2007
epibranchial field sox3 expression decreased amount, abnormal fgf8ati282a/ti282a + MO1-fgf3 standard conditions Fig. 5 with image from Sun et al., 2007
otic vesicle decreased size, abnormal WT + MO1-fgf3 + MO2-fgf3 + MO6-pax8 + MO7-pax8 standard conditions Fig. 4 with image from Mackereth et al., 2005
otic vesicle morphogenesis process quality, abnormal WT + MO1-fgf3 + MO2-fgf3 + MO6-pax8 + MO7-pax8 standard conditions Fig. 4 with image from Mackereth et al., 2005
otic placode physical object quality, abnormal WT + MO1-fgf3 + MO2-fgf3 + MO6-pax8 + MO7-pax8 standard conditions Fig. 4 with image from Mackereth et al., 2005
epibranchial field pax2a expression absent, abnormal WT + MO1-fgf3 + MO3-fgf8a standard conditions Fig. 5 with image from Sun et al., 2007
midbrain development disrupted, abnormal WT + MO1-fgf3 + MO3-fgf8a standard conditions Fig. 9 with image from Miyake et al., 2014
epibranchial field sox3 expression absent, abnormal WT + MO1-fgf3 + MO3-fgf8a standard conditions Fig. 5 with image from Sun et al., 2007
Citations