CRISPR

CRISPR6-aip

ID

ZDB-CRISPR-260513-2

Name

CRISPR6-aip

Previous Names

None

Target

aip (1)

Sequence

5' - AGCGTCCAGGTGATGAGCAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
wh239	aip

Expression

Gene expression in Wild Types + CRISPR6-aip

No data available

Phenotype

Phenotype resulting from CRISPR6-aip

No data available

Phenotype of all Fish created by or utilizing CRISPR6-aip

Phenotype	Fish	Conditions	Figures
axis decreased object quality, abnormal	aip^wh239/wh239	chemical treatment by environment: Benzo[k]fluoranthene	FIGURE 1 from Perone et al., 2026
pericardium edematous, abnormal	aip^wh239/wh239	chemical treatment by environment: 5-Nitroacenaphthene	FIGURE 1 from Perone et al., 2026
cellular response to stress increased occurrence, abnormal	aip^wh239/wh239	standard conditions	FIGURE 6 from Perone et al., 2026
brain malformed, abnormal	aip^wh239/wh239	chemical treatment by environment: leflunomide	FIGURE 1 from Perone et al., 2026
cranium malformed, ameliorated	aip^wh239/wh239	chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl	FIGURE 1 from Perone et al., 2026
pericardium edematous, abnormal	aip^wh239/wh239	chemical treatment by environment: Benzo[k]fluoranthene	FIGURE 1 from Perone et al., 2026
regulation of response to oxidative stress increased occurrence, abnormal	aip^wh239/wh239	standard conditions	FIGURE 6 from Perone et al., 2026
cranium malformed, exacerbated	aip^wh239/wh239	chemical treatment by environment: leflunomide	FIGURE 1 from Perone et al., 2026
cranium malformed, abnormal	aip^wh239/wh239	chemical treatment by environment: Benzo[k]fluoranthene	FIGURE 1 from Perone et al., 2026
thigmotaxis decreased process quality, abnormal	aip^wh239/wh239	chemical treatment by environment: leflunomide	FIGURE 1 from Perone et al., 2026
startle response increased magnitude, abnormal	aip^wh239/wh239	acoustic radiation	FIGURE 2 from Perone et al., 2026
regulation of cell division decreased occurrence, abnormal	aip^wh239/wh239	standard conditions	FIGURE 6 from Perone et al., 2026
brain malformed, ameliorated	aip^wh239/wh239	chemical treatment by environment: 5-Nitroacenaphthene	FIGURE 1 from Perone et al., 2026
pericardium edematous, ameliorated	aip^wh239/wh239	chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl	FIGURE 1 from Perone et al., 2026
gene expression decreased process quality, abnormal	aip^wh239/wh239	standard conditions	FIGURE 9 , FIGURE 10 from Perone et al., 2026
brain malformed, abnormal	aip^wh239/wh239	chemical treatment by environment: Benzo[k]fluoranthene	FIGURE 1 from Perone et al., 2026
cranium malformed, abnormal	aip^wh239/wh239	chemical treatment by environment: 5-Nitroacenaphthene	FIGURE 1 from Perone et al., 2026
startle response increased magnitude, abnormal	aip^wh239/wh239	lighting conditions	FIGURE 2 from Perone et al., 2026
fin malformed, ameliorated	aip^wh239/wh239	chemical treatment by environment: Benzo[k]fluoranthene	FIGURE 1 from Perone et al., 2026
response to light stimulus increased magnitude, abnormal	aip^wh239/wh239	acoustic radiation	FIGURE 2 from Perone et al., 2026
cellular response to nutrient increased occurrence, abnormal	aip^wh239/wh239	standard conditions	FIGURE 6 from Perone et al., 2026
lipid metabolic process increased occurrence, abnormal	aip^wh239/wh239	standard conditions	FIGURE 6 from Perone et al., 2026
muscle malformed, ameliorated	aip^wh239/wh239	chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl	FIGURE 1 from Perone et al., 2026
whole organism aip expression decreased amount, abnormal	aip^wh239/wh239	standard conditions	FIGURE 5 from Perone et al., 2026
response to light stimulus increased magnitude, exacerbated	aip^wh239/wh239	lighting conditions, chemical treatment by environment: leflunomide	FIGURE 3 from Perone et al., 2026
xenobiotic metabolic process increased occurrence, abnormal	aip^wh239/wh239	standard conditions	FIGURE 6 from Perone et al., 2026
response to light stimulus increased magnitude, abnormal	aip^wh239/wh239	lighting conditions	FIGURE 2 from Perone et al., 2026
thigmotaxis decreased process quality, abnormal	aip^wh239/wh239	chemical treatment by environment: 5-Nitroacenaphthene	FIGURE 1 from Perone et al., 2026
amino acid metabolic process increased occurrence, abnormal	aip^wh239/wh239	standard conditions	FIGURE 6 from Perone et al., 2026
pericardium edematous, exacerbated	aip^wh239/wh239	chemical treatment by environment: leflunomide	FIGURE 1 from Perone et al., 2026
axis decreased object quality, exacerbated	aip^wh239/wh239	chemical treatment by environment: 5-Nitroacenaphthene	FIGURE 1 from Perone et al., 2026
whole organism aip expression decreased amount, abnormal	aip^wh239/wh239 (TL)	standard conditions	Fig. 6. from Karchner et al., 2026
whole organism viability, abnormal	aip^wh239/wh239 (TL)	standard conditions	Fig. 3. from Karchner et al., 2026
whole organism dead, abnormal	aip^wh239/wh239 (TL)	standard conditions	Fig. 3. from Karchner et al., 2026
whole organism aip expression decreased amount, abnormal	aip^wh239/+	standard conditions	FIGURE 5 from Perone et al., 2026
whole organism aip expression decreased amount, abnormal	aip^wh239/+ (TL)	standard conditions	Fig. 6. from Karchner et al., 2026

Citations