CRISPR

CRISPR1-galcb

ID
ZDB-CRISPR-251118-4
Name
CRISPR1-galcb
Previous Names
None
Target
Sequence
5' - GGCATTGGTGGATTAAGCGGTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ubx102 galcb
Expression
Gene expression in Wild Types + CRISPR1-galcb
No data available
Phenotype
Phenotype resulting from CRISPR1-galcb
No data available
Phenotype of all Fish created by or utilizing CRISPR1-galcb
Phenotype Fish Conditions Figures
swimming behavior process quality, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 2 with image from Guerra et al., 2025
brain neu1 expression increased amount, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 6 with image from Guerra et al., 2025
brain gfap expression increased amount, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 4 with image from Guerra et al., 2025
brain decreased weight, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 1 with image from Guerra et al., 2025
whole organism decreased weight, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 1 with image from Guerra et al., 2025
diencephalon axon cytoplasm increased accumulation neuron lysosome, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 3 with image from Guerra et al., 2025
whole organism decreased length, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 1 with image from Guerra et al., 2025
brain myelination decreased process quality, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 3 with image from Guerra et al., 2025
whole organism sterile, abnormal galcbubx102/ubx102 (AB) standard conditions text only from Guerra et al., 2025
brain rbfox3a expression decreased amount, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 4 with image from Guerra et al., 2025
brain nes expression increased amount, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 4 with image from Guerra et al., 2025
brain asah1a expression increased amount, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 6 with image from Guerra et al., 2025
diencephalon axon degenerate, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 3 with image from Guerra et al., 2025
brain neurod1 expression decreased amount, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 4 with image from Guerra et al., 2025
brain tnfa expression increased amount, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 4 with image from Guerra et al., 2025
diencephalon myelin sheath decreased thickness, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 3 with image from Guerra et al., 2025
diencephalon axon cytoplasm increased accumulation neuron mitochondrion, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 3 with image from Guerra et al., 2025
brain mpeg1.1 expression increased amount, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 4 with image from Guerra et al., 2025
brain gm2a expression increased amount, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 6 with image from Guerra et al., 2025
brain mpz expression decreased amount, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 3 with image from Guerra et al., 2025
brain glb1 expression increased amount, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 6 with image from Guerra et al., 2025
brain asah1b expression increased amount, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 6 with image from Guerra et al., 2025
optic tectum myelination decreased process quality, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 3 with image from Guerra et al., 2025
brain cxcl8b.1 expression increased amount, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 4 with image from Guerra et al., 2025
brain apoeb expression increased amount, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 4 with image from Guerra et al., 2025
brain il1b expression increased amount, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 4 with image from Guerra et al., 2025
brain Ab11-mbp labeling increased amount, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 3 with image from Guerra et al., 2025
whole organism decreased life span, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 1 with image from Guerra et al., 2025
brain degs1 expression increased amount, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 6 with image from Guerra et al., 2025
brain galactosylceramidase activity decreased occurrence, abnormal galcbubx102/ubx102 (AB) standard conditions Fig. 1 with image from Guerra et al., 2025
Citations