CRISPR

CRISPR1-spint2

ID

ZDB-CRISPR-220322-3

Name

CRISPR1-spint2

Previous Names

None

Target

spint2 (1)

Sequence

5' - AGATCGCGGAGACCACCAAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
fr49	spint2

Expression

Gene expression in Wild Types + CRISPR1-spint2

No data available

Phenotype

Phenotype resulting from CRISPR1-spint2

No data available

Phenotype of all Fish created by or utilizing CRISPR1-spint2

Phenotype	Fish	Conditions	Figures
hatching gland cell division increased frequency, abnormal	spint2^fr49/fr49 (TL)	standard conditions	Fig. 7 from Hatzold et al., 2021
otic vesicle spint2 expression decreased amount, abnormal	spint2^fr49/fr49 (TL)	standard conditions	Fig. 1 from Hatzold et al., 2021
hatching gland hatching gland cell irregular spatial pattern, abnormal	spint2^fr49/fr49 (TL)	standard conditions	Fig. 3 from Hatzold et al., 2021
hatching gland ctslb expression decreased amount, abnormal	spint2^fr49/fr49 (TL)	standard conditions	Fig. 7 from Hatzold et al., 2021
pronephric duct spint2 expression decreased amount, abnormal	spint2^fr49/fr49 (TL)	standard conditions	Fig. 1 from Hatzold et al., 2021
hatching gland cell lateral plasma membrane ab2-cdh1 labeling decreased amount, abnormal	spint2^fr49/fr49 (TL)	standard conditions	Fig. 8 from Hatzold et al., 2021
hatching gland epithelial structure maintenance disrupted, abnormal	spint2^fr49/fr49 (TL)	standard conditions	Fig. 8 from Hatzold et al., 2021
hatching gland ctslb expression spatial pattern, abnormal	spint2^fr49/fr49 (TL)	standard conditions	Fig. 3 , Fig. 7 from Hatzold et al., 2021
intervillus pockets cell division increased frequency, abnormal	spint2^fr49/fr49 (TL)	standard conditions	Fig. 2 from Hatzold et al., 2021
goblet cell decreased amount, abnormal	spint2^fr49/fr49 (TL)	standard conditions	Fig. 2 from Hatzold et al., 2021
peridermal cell spint2 expression decreased amount, abnormal	spint2^fr49/fr49 (TL)	standard conditions	Fig. 1 from Hatzold et al., 2021
primitive olfactory epithelium spint2 expression decreased amount, abnormal	spint2^fr49/fr49 (TL)	standard conditions	Fig. 1 from Hatzold et al., 2021
intestinal epithelium decreased object quality, abnormal	spint2^fr49/fr49 (TL)	standard conditions	Fig. 2 from Hatzold et al., 2021
hatching gland secretory granule decreased amount, abnormal	spint2^fr49/fr49 (TL)	standard conditions	Fig. 7 from Hatzold et al., 2021
hatching gland cell cell-cell adhesion disrupted, abnormal	spint2^fr49/fr49 (TL)	standard conditions	Fig. 8 from Hatzold et al., 2021
hatching gland EGFP expression decreased amount, abnormal	spint2^fr49/fr49; a131Tg/a131Tg; fr44Tg/fr44Tg	standard conditions	Fig. 7 from Hatzold et al., 2021
hatching gland decreased amount, abnormal	spint2^fr49/fr49; a131Tg/a131Tg; fr44Tg/fr44Tg	standard conditions	Fig. 7 from Hatzold et al., 2021
hatching gland cell-cell adhesion decreased efficacy, abnormal	spint2^fr49/fr49; ml1Tg/ml1Tg	standard conditions	Fig. 6 from Hatzold et al., 2021
hatching gland morphogenesis of an epithelial sheet decreased process quality, abnormal	spint2^fr49/fr49; ml1Tg/ml1Tg	standard conditions	Fig. 6 from Hatzold et al., 2021
hatching gland directional locomotion decreased process quality, abnormal	spint2^fr49/fr49; ml1Tg/ml1Tg	standard conditions	Fig. 6 from Hatzold et al., 2021
hatching gland regulation of cell shape decreased process quality, abnormal	spint2^fr49/fr49; vu119Tg/vu119Tg	standard conditions	Fig. 6 from Hatzold et al., 2021
hatching gland cell-cell adhesion decreased efficacy, abnormal	spint2^fr49/fr49; vu119Tg/vu119Tg	standard conditions	Fig. 6 from Hatzold et al., 2021
hatching gland morphogenesis of an epithelial sheet decreased process quality, abnormal	spint2^fr49/fr49; vu119Tg/vu119Tg	standard conditions	Fig. 6 from Hatzold et al., 2021

Citations