CRISPR

CRISPR1-pheta1

ID

ZDB-CRISPR-210105-8

Name

CRISPR1-pheta1

Previous Names

CRISPR1-si:ch211-193c2.2

Target

pheta1 (1)

Sequence

5' - GGAGCTGAACGAGAGGAGTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The first two "G"s were added.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
vt2	pheta1

Expression

Gene expression in Wild Types + CRISPR1-pheta1

No data available

Phenotype

Phenotype resulting from CRISPR1-pheta1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-pheta1

Phenotype	Fish	Conditions	Figures
Meckel's cartilage decreased area, abnormal	pheta1^vt2/vt2	standard conditions	Fig. 4. from Ates et al., 2020
pinocytosis decreased efficacy, abnormal	pheta1^vt2/vt2	standard conditions	Fig. 3. from Ates et al., 2020
ventral mandibular arch decreased width, abnormal	pheta1^vt2/vt2	standard conditions	Fig. 7. from Ates et al., 2020
pronephros cilium decreased amount, abnormal	pheta1^vt2/vt2	standard conditions	Fig. 3. from Ates et al., 2020
ventral mandibular arch decreased width and length, abnormal	pheta1^vt2/vt2	standard conditions	Fig. 4. from Ates et al., 2020
pronephros cilium decreased length, abnormal	pheta1^vt2/vt2	standard conditions	Fig. 3. from Ates et al., 2020
chondrocyte axis elongation disrupted, abnormal	pheta1^vt2/vt2	standard conditions	Fig. 5. from Ates et al., 2020
ventral mandibular arch decreased length, abnormal	pheta1^vt2/+; vt5Tg	standard conditions	Fig. 7. from Ates et al., 2020
ventral mandibular arch decreased width, abnormal	pheta1^vt2/vt2; vt4Tg	standard conditions	Fig. 7. from Ates et al., 2020
ventral mandibular arch decreased width, abnormal	pheta1^vt2/vt2; vt5Tg	standard conditions	Fig. 7. from Ates et al., 2020
chondrocyte axis elongation disrupted, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	standard conditions	Fig. 5. from Ates et al., 2020
cranium decreased length, ameliorated	pheta1^vt2/vt2; pheta2^vt3/vt3	chemical treatment: EC 3.4.22.38 (cathepsin K) inhibitor	Fig. 6. from Ates et al., 2020
ceratohyal cartilage decreased length, ameliorated	pheta1^vt2/vt2; pheta2^vt3/vt3	chemical treatment: EC 3.4.22.38 (cathepsin K) inhibitor	Fig. 6. from Ates et al., 2020
ceratohyal cartilage ab1-col2a labeling increased amount, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	standard conditions	Fig. 5. from Ates et al., 2020
ventral mandibular arch decreased width and length, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	standard conditions	Fig. 4. from Ates et al., 2020
Meckel's cartilage decreased area, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	standard conditions	Fig. 4. , Fig. 6. from Ates et al., 2020
cranium decreased length, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	standard conditions	Fig. 4. , Fig. 6. from Ates et al., 2020
ventral mandibular arch increased length, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	chemical treatment: EC 3.4.22.38 (cathepsin K) inhibitor	Fig. 6. from Ates et al., 2020
pronephros cilium decreased length, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	standard conditions	Fig. 3. from Ates et al., 2020
ventral mandibular arch decreased width, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	control	Fig. 6. from Ates et al., 2020
Meckel's cartilage ab1-col2a labeling increased amount, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	standard conditions	Fig. 5. from Ates et al., 2020
Meckel's cartilage decreased area, ameliorated	pheta1^vt2/vt2; pheta2^vt3/vt3	chemical treatment: EC 3.4.22.38 (cathepsin K) inhibitor	Fig. 6. from Ates et al., 2020
pronephros cilium decreased amount, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	standard conditions	Fig. 3. from Ates et al., 2020
ceratohyal bone ossification decreased process quality, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	standard conditions	Fig. 4. from Ates et al., 2020
ceratohyal cartilage decreased width, ameliorated	pheta1^vt2/vt2; pheta2^vt3/vt3	chemical treatment: EC 3.4.22.38 (cathepsin K) inhibitor	Fig. 6. from Ates et al., 2020
ceratohyal cartilage decreased width, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	control	Fig. 6. from Ates et al., 2020
ceratohyal cartilage decreased length, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	standard conditions	Fig. 4. , Fig. 6. from Ates et al., 2020
ventral mandibular arch decreased width, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	chemical treatment: EC 3.4.22.38 (cathepsin K) inhibitor	Fig. 6. from Ates et al., 2020

Citations