CRISPR

CRISPR1-myo1g

ID

ZDB-CRISPR-190211-2

Name

CRISPR1-myo1g

Previous Names

None

Target

myo1g (1)

Sequence

5' - GATGTCATTGAGGACTACAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
nce18b	myo1g
nce18c	myo1g
nce18e	myo1g

Expression

Gene expression in Wild Types + CRISPR1-myo1g

No data available

Phenotype

Phenotype resulting from CRISPR1-myo1g

No data available

Phenotype of all Fish created by or utilizing CRISPR1-myo1g

Phenotype	Fish	Conditions	Figures
segmental plate dand5 expression decreased amount, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 6 from Kurup et al., 2024
whole organism spaw expression decreased amount, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 4 from Kurup et al., 2024
heart jogging decreased process quality, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
germ ring Ab9-smad2 labeling decreased amount, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 5 from Kurup et al., 2024
heart primordium lft2 expression spatial pattern, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 2 from Kurup et al., 2024
segmental plate ndr2 expression decreased amount, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 6 from Kurup et al., 2024
epithalamus left/right pattern formation decreased process quality, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
endosomal transport decreased process quality, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 7 , Fig. 8 from Kurup et al., 2024
segmental plate lft1 expression decreased amount, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 6 from Kurup et al., 2024
brain left/right pattern formation decreased process quality, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
segmental plate spaw expression decreased amount, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 4 from Kurup et al., 2024
epithalamus dorsal side pitx2 expression decreased amount, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
forebrain neural rod lft1 expression decreased amount, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 6 from Kurup et al., 2024
heart primordium lft2 expression decreased amount, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 2 from Kurup et al., 2024
lateral plate mesoderm left side spaw expression decreased amount, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 4 from Kurup et al., 2024
segmental plate gdf3 expression decreased amount, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 6 from Kurup et al., 2024
lateral plate mesoderm left side pitx2 expression spatial pattern, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 2 from Kurup et al., 2024
forebrain neural rod lft1 expression spatial pattern, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 6 from Kurup et al., 2024
whole organism lft1 expression decreased amount, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 5 from Kurup et al., 2024
lateral plate mesoderm left side spaw expression spatial pattern, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 2 from Kurup et al., 2024
notochord lft1 expression spatial pattern, abnormal	myo1g^{nce18b/nce18b}	standard conditions	Fig. 2 , Fig. 4 from Kurup et al., 2024
lateral plate mesoderm left side spaw expression spatial pattern, abnormal	myo1g^{nce18b/nce18b} + MO1-dnaaf1	standard conditions	Fig. 3 from Kurup et al., 2024
lateral plate mesoderm left side spaw expression decreased amount, abnormal	myo1g^{nce18b/nce18b} + MO1-dnaaf1	standard conditions	Fig. 3 from Kurup et al., 2024
heart primordium regulation of nodal signaling pathway decreased process quality, abnormal	myo1g^{nce18b/nce18b} + MO1-dnaaf1	standard conditions	Fig. 3 from Kurup et al., 2024
notochord absent, exacerbated	myo1g^{nce18b/nce18b} + MO1-ndr2 + MO4-ndr1	standard conditions	Fig. 5 from Kurup et al., 2024
formation of primary germ layer decreased process quality, abnormal	myo1g^{nce18b/nce18b} + MO1-ndr2 + MO4-ndr1	standard conditions	Fig. 5 from Kurup et al., 2024
heart primordium regulation of nodal signaling pathway decreased process quality, abnormal	dnaaf1^{tm317b/tm317b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 3 from Kurup et al., 2024
heart jogging decreased process quality, abnormal	dnaaf1^{tm317b/tm317b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
pancreas left/right pattern formation decreased process quality, abnormal	dnaaf1^{tm317b/tm317b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
lateral plate mesoderm left side spaw expression spatial pattern, abnormal	dnaaf1^{tm317b/tm317b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 3 from Kurup et al., 2024
lateral plate mesoderm left side spaw expression decreased amount, abnormal	dnaaf1^{tm317b/tm317b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 3 from Kurup et al., 2024
brain left/right pattern formation decreased process quality, abnormal	dnaaf1^{tm317b/tm317b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
gut left/right pattern formation decreased process quality, abnormal	dnaaf1^{tm317b/tm317b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
epithalamus dorsal side pitx2 expression decreased amount, abnormal	myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
determination of heart left/right asymmetry decreased process quality, exacerbated	myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Juan et al., 2018
epithalamus dorsal side pitx2 expression spatial pattern, abnormal	myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
lateral plate mesoderm left side spaw expression spatial pattern, abnormal	myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 2 from Kurup et al., 2024
Kupffer's vesicle epithelial cilium movement involved in determination of left/right asymmetry process quality, abnormal	myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 4 from Juan et al., 2018
brain left/right pattern formation decreased process quality, abnormal	myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
lateral plate mesoderm left side pitx2 expression spatial pattern, abnormal	myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 2 from Kurup et al., 2024
heart tube mislocalised, exacerbated	myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Juan et al., 2018
liver foxa1 expression spatial pattern, abnormal	myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
heart mislocalised, exacerbated	myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Juan et al., 2018
heart heart looping decreased process quality, exacerbated	myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Juan et al., 2018
Kupffer's vesicle dand5 expression spatial pattern, abnormal	myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 2 from Juan et al., 2018
gut foxa1 expression spatial pattern, abnormal	myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
pancreas foxa1 expression spatial pattern, abnormal	myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
heart tube heart jogging decreased process quality, exacerbated	myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Juan et al., 2018
epithalamus left/right pattern formation decreased process quality, abnormal	myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
notochord lft1 expression spatial pattern, abnormal	myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 2 from Kurup et al., 2024
heart jogging decreased process quality, exacerbated	myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
pancreas left/right pattern formation decreased process quality, abnormal	myo1g^{nce18b/nce18b}; myo1d^{nce16c/nce16c}	standard conditions	Fig. 1 from Kurup et al., 2024
brain left/right pattern formation decreased process quality, abnormal	myo1g^{nce18b/nce18b}; myo1d^{nce16c/nce16c}	standard conditions	Fig. 1 from Kurup et al., 2024
gut left/right pattern formation decreased process quality, abnormal	myo1g^{nce18b/nce18b}; myo1d^{nce16c/nce16c}	standard conditions	Fig. 1 from Kurup et al., 2024
heart jogging decreased process quality, exacerbated	myo1g^{nce18b/nce18b}; myo1d^{nce16c/nce16c}	standard conditions	Fig. 1 from Kurup et al., 2024
heart primordium lft2 expression decreased amount, abnormal	myo1g^{nce18b/nce18b}; myo1d^{nce16c/nce16c}	standard conditions	Fig. 2 from Kurup et al., 2024
heart primordium lft2 expression spatial pattern, abnormal	myo1g^{nce18b/nce18b}; myo1d^{nce16c/nce16c}	standard conditions	Fig. 2 from Kurup et al., 2024
pancreas left/right pattern formation decreased process quality, abnormal	dnaaf1^{tm317b/tm317b}; myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
lateral plate mesoderm left side spaw expression spatial pattern, abnormal	dnaaf1^{tm317b/tm317b}; myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 3 from Kurup et al., 2024
shield maintenance of ciliary planar beating movement pattern decreased process quality, abnormal	dnaaf1^{tm317b/tm317b}; myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
brain left/right pattern formation decreased process quality, abnormal	dnaaf1^{tm317b/tm317b}; myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
lateral plate mesoderm left side spaw expression decreased amount, abnormal	dnaaf1^{tm317b/tm317b}; myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 3 from Kurup et al., 2024
liver foxa1 expression spatial pattern, abnormal	dnaaf1^{tm317b/tm317b}; myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
gut left/right pattern formation decreased process quality, abnormal	dnaaf1^{tm317b/tm317b}; myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
pancreas foxa1 expression spatial pattern, abnormal	dnaaf1^{tm317b/tm317b}; myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
gut foxa1 expression spatial pattern, abnormal	dnaaf1^{tm317b/tm317b}; myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
heart jogging decreased process quality, exacerbated	dnaaf1^{tm317b/tm317b}; myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b}	standard conditions	Fig. 1 from Kurup et al., 2024
lateral plate mesoderm left side spaw expression spatial pattern, abnormal	myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b} + MO1-dnaaf1	standard conditions	Fig. 3 from Kurup et al., 2024
lateral plate mesoderm left side spaw expression decreased amount, abnormal	myo1d^{nce16b/nce16b}; myo1g^{nce18b/nce18b} + MO1-dnaaf1	standard conditions	Fig. 3 from Kurup et al., 2024

Citations