CRISPR

CRISPR1-tpcn2

ID

ZDB-CRISPR-170630-6

Name

CRISPR1-tpcn2

Previous Names

None

Target

tpcn2 (1)

Sequence

5' - GGACCCTTCCCGAGATAGCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
dhkz1a	tpcn2

Expression

Gene expression in Wild Types + CRISPR1-tpcn2

No data available

Phenotype

Phenotype resulting from CRISPR1-tpcn2

No data available

Phenotype of all Fish created by or utilizing CRISPR1-tpcn2

Phenotype	Fish	Conditions	Figures
striated muscle cell decreased width, abnormal	tpcn2^{dhkz1a/dhkz1a} (AB/TU)	standard conditions	Fig. 4 from Kelu et al., 2017
slow muscle cell sarcomere morphology, abnormal	tpcn2^{dhkz1a/dhkz1a} (AB/TU)	standard conditions	Fig. 3 from Kelu et al., 2017
slow muscle cell decreased amount, abnormal	tpcn2^{dhkz1a/dhkz1a} (AB/TU)	standard conditions	Fig. 4 from Kelu et al., 2017
myotome decreased width, abnormal	tpcn2^{dhkz1a/dhkz1a} (AB/TU)	standard conditions	Fig. 3 , Fig. 4 from Kelu et al., 2017
blood cell accumulation heart, abnormal	tpcn2^{dhkz1a/dhkz1a} (AB/TU)	control	Fig. 2 from Kelu et al., 2017
striated muscle cell increased length, abnormal	tpcn2^{dhkz1a/dhkz1a} (AB/TU)	standard conditions	Fig. 4 from Kelu et al., 2017
head decreased pigmentation, abnormal	tpcn2^{dhkz1a/dhkz1a} (AB/TU)	control	Fig. 2 from Kelu et al., 2017
somite U-shaped, abnormal	tpcn2^{dhkz1a/dhkz1a} (AB/TU)	standard conditions	Fig. 3 , Fig. 4 from Kelu et al., 2017
eye decreased pigmentation, abnormal	tpcn2^{dhkz1a/dhkz1a} (AB/TU)	control	Fig. 2 from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril disorganized, abnormal	tpcn2^{dhkz1a/dhkz1a} (AB/TU)	standard conditions	Fig. 3 from Kelu et al., 2017
trunk decreased pigmentation, abnormal	tpcn2^{dhkz1a/dhkz1a} (AB/TU)	control	Fig. 2 from Kelu et al., 2017
striated muscle cell increased length, abnormal	tpcn2^dhkz1a/+ (AB/TU)	standard conditions	Fig. 4 from Kelu et al., 2017
somite U-shaped, abnormal	tpcn2^dhkz1a/+ (AB/TU)	standard conditions	Fig. 3 , Fig. 4 from Kelu et al., 2017
slow muscle cell sarcomere morphology, abnormal	tpcn2^dhkz1a/+ (AB/TU)	standard conditions	Fig. 3 from Kelu et al., 2017
myotome decreased width, abnormal	tpcn2^dhkz1a/+ (AB/TU)	standard conditions	Fig. 3 , Fig. 4 from Kelu et al., 2017
striated muscle cell decreased width, abnormal	tpcn2^dhkz1a/+ (AB/TU)	standard conditions	Fig. 4 from Kelu et al., 2017
slow muscle cell decreased amount, abnormal	tpcn2^dhkz1a/+ (AB/TU)	standard conditions	Fig. 4 from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril disorganized, abnormal	tpcn2^dhkz1a/+ (AB/TU)	standard conditions	Fig. 3 from Kelu et al., 2017
CaP motoneuron release of sequestered calcium ion into cytosol asynchronous, abnormal	tpcn2^{dhkz1a/dhkz1a}; nksaigff213aGt; zf415Tg	standard conditions	Fig. 1 from Kelu et al., 2018
CaP motoneuron release of sequestered calcium ion into cytosol occurrence, abnormal	tpcn2^{dhkz1a/dhkz1a}; nksaigff213aGt; zf415Tg	standard conditions	Fig. 1 from Kelu et al., 2018

Citations