CRISPR

CRISPR2-gemin5

ID
ZDB-CRISPR-160128-221
Name
CRISPR2-gemin5
Previous Names
  • Z000294 (1)
Target
Sequence
5' - GGGACAGCATGATCCGCGTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hg80 gemin5
hg81 gemin5
Expression
Gene expression in Wild Types + CRISPR2-gemin5
No data available
Phenotype
Phenotype resulting from CRISPR2-gemin5
No data available
Phenotype of all Fish created by or utilizing CRISPR2-gemin5
Phenotype Fish Conditions Figures
whole organism viability, abnormal gemin5hg80/hg80 standard conditions text only from Pei et al., 2018
ventral fin fold regeneration disrupted, abnormal gemin5hg80/hg80 amputation: ventral fin fold Fig. 4 with image from Pei et al., 2018
posterior lateral line neuromast has fewer parts of type neuromast hair cell, abnormal gemin5hg80/hg80 chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. 3 with image from Pei et al., 2018
neuromast hair cell regeneration disrupted, abnormal gemin5hg80/hg80 chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. 3 with image from Pei et al., 2018
neuromast regeneration decreased process quality, abnormal gemin5hg81/hg81 chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. 2 with image,  Fig. 3 with image from Pei et al., 2020
neuromast hair cell regeneration disrupted, abnormal gemin5hg81/hg81 chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. 8 with image from Pei et al., 2020
neuromast amount, ameliorated gemin5hg81/hg81 chemical treatment by environment: tyrphostin AG 1478 Fig. 6 with image from Pei et al., 2020
neuromast hair cell amount, ameliorated gemin5hg81/hg81 chemical treatment by environment: tyrphostin AG 1478, chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. 8 with image from Pei et al., 2020
neuromast decreased size, abnormal gemin5hg81/hg81 chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. 2 with image from Pei et al., 2020
neuromast hair cell cell population proliferation decreased process quality, abnormal gemin5hg81/hg81 chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. 3 with image from Pei et al., 2020
neuromast hair cell regeneration process quality, ameliorated gemin5hg81/hg81 chemical treatment by environment: tyrphostin AG 1478, chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. 8 with image from Pei et al., 2020
whole organism viability, abnormal gemin5hg81/hg81 standard conditions text only from Pei et al., 2018
neuromast hair cell decreased amount, abnormal gemin5hg81/hg81 chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. 3 with image,  Fig. 8 with image from Pei et al., 2020
posterior lateral line neuromast has fewer parts of type neuromast hair cell, abnormal gemin5hg81/hg81 chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. S7 from Pei et al., 2020
ventral fin fold regeneration disrupted, abnormal gemin5hg81/hg81 amputation: ventral fin fold Fig. 4 with image from Pei et al., 2018
posterior lateral line neuromast has fewer parts of type neuromast hair cell, abnormal gemin5hg81/hg81 chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. 3 with image from Pei et al., 2018
neuromast hair cell regeneration decreased process quality, abnormal gemin5hg81/hg81 chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. S7 from Pei et al., 2020
neuromast hair cell regeneration disrupted, abnormal gemin5hg81/hg81 chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. 3 with image from Pei et al., 2018
neuromast hair cell amount, ameliorated gemin5hg81/hg81; s273tTg; sqet20Et chemical treatment by environment: tyrphostin AG 1478 Fig. 6 with image from Pei et al., 2020
neuromast mantle cell amount, ameliorated gemin5hg81/hg81; s273tTg; sqet20Et chemical treatment by environment: tyrphostin AG 1478 Fig. 6 with image from Pei et al., 2020
neuromast decreased size, abnormal gemin5hg81/hg81; zf106Tg chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. 2 with image from Pei et al., 2020
neuromast regeneration decreased process quality, abnormal gemin5hg81/hg81; zf106Tg chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. 2 with image from Pei et al., 2020
neuromast EGFP expression decreased distribution, abnormal gemin5hg81/hg81; zf106Tg chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. 2 with image from Pei et al., 2020
neuromast amount, ameliorated erbb3bhg115/hg115; gemin5hg81/hg81 control Fig. 7 with image from Pei et al., 2020
liver regeneration disrupted, abnormal gemin5hg80/hg80; s931Tg/+ chemical ablation: liver, chemical treatment: metronidazole Fig. 5 with image from Pei et al., 2018
liver decreased size, abnormal gemin5hg80/hg80; s931Tg/+ chemical ablation: liver, chemical treatment: metronidazole Fig. 5 with image from Pei et al., 2018
neuromast amount, ameliorated gemin5hg81/hg81; nrg1hg114/hg114 control Fig. 7 with image from Pei et al., 2020
liver regeneration disrupted, abnormal gemin5hg81/hg81; s931Tg/+ chemical ablation: liver, chemical treatment: metronidazole Fig. 5 with image from Pei et al., 2018
liver decreased size, abnormal gemin5hg81/hg81; s931Tg/+ chemical ablation: liver, chemical treatment: metronidazole Fig. 5 with image from Pei et al., 2018
neuromast hair cell decreased amount, abnormal gemin5hg81/hg81; tnks1bp1y229Gt; nns8Tg chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. 2 with image from Pei et al., 2020
neuromast support cell decreased area, abnormal gemin5hg81/hg81; tnks1bp1y229Gt; nns8Tg chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. 2 with image from Pei et al., 2020
neuromast support cell EGFP expression decreased distribution, abnormal gemin5hg81/hg81; tnks1bp1y229Gt; nns8Tg chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. 2 with image from Pei et al., 2020
neuromast regeneration decreased process quality, abnormal gemin5hg81/hg81; tnks1bp1y229Gt; nns8Tg chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. 2 with image from Pei et al., 2020
neuromast hair cell Tomato expression absent, abnormal gemin5hg81/hg81; tnks1bp1y229Gt; nns8Tg chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. 2 with image from Pei et al., 2020
posterior lateral line neuromast has fewer parts of type neuromast hair cell, abnormal tp53zdf1/zdf1; gemin5hg81/hg81 chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. S7 from Pei et al., 2020
neuromast hair cell regeneration decreased process quality, abnormal tp53zdf1/zdf1; gemin5hg81/hg81 chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell Fig. S7 from Pei et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.