CRISPR

CRISPR1-tjp1b

ID
ZDB-CRISPR-150731-12
Name
CRISPR1-tjp1b
Previous Names
  • Z000460 (1)
Target
Sequence
5' - GAGTGCAGCAATGGATGAGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
b1370 tjp1b
fh448 tjp1b
fh449 tjp1b
fh451 tjp1b
Expression
Gene expression in Wild Types + CRISPR1-tjp1b
No data available
Phenotype
Phenotype resulting from CRISPR1-tjp1b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-tjp1b
Phenotype Fish Conditions Figures
Mauthner neuron chemical synaptic transmission absent process, abnormal tjp1bb1370/b1370 mechanical stress, chemical treatment by environment: 6-Cyano-7-nitroquinoxaline-2,3-dione, chemical treatment by environment: 2-amino-5-phosphonopentanoic acid Figure 3 with image from Lasseigne et al., 2021
Mauthner neuron chemical synaptic transmission normal occurrence, ameliorated tjp1bb1370/b1370 chemical treatment by environment: 6-Cyano-7-nitroquinoxaline-2,3-dione, chemical treatment by environment: 2-amino-5-phosphonopentanoic acid Figure 4 with image from Lasseigne et al., 2021
startle response increased sensitivity of a process detection of mechanical stimulus, abnormal tjp1bb1370/b1370 mechanical stress Figure 5-source data 1. with image from Lasseigne et al., 2021
Mauthner neuron chemical synaptic transmission increased magnitude, abnormal tjp1bb1370/b1370 standard conditions Figure 4 with image from Lasseigne et al., 2021
Mauthner neuron cell communication by electrical coupling decreased occurrence, abnormal tjp1bb1370/b1370 mechanical stress Figure 3 with image from Lasseigne et al., 2021
Mauthner neuron cell communication by electrical coupling decreased magnitude, abnormal tjp1bb1370/b1370 mechanical stress, chemical treatment by environment: 6-Cyano-7-nitroquinoxaline-2,3-dione, chemical treatment by environment: 2-amino-5-phosphonopentanoic acid Figure 3 with image from Lasseigne et al., 2021
startle response delayed, abnormal tjp1bb1370/b1370 mechanical stress Figure 5-source data 1. with image from Lasseigne et al., 2021
Mauthner neuron cell communication by electrical coupling decreased frequency, abnormal tjp1bb1370/b1370 standard conditions Figure 4 with image from Lasseigne et al., 2021
startle response decreased magnitude, abnormal tjp1bb1370/b1370 mechanical stress Figure 5-source data 1. with image from Lasseigne et al., 2021
Mauthner neuron protein localization to synapse disrupted, abnormal tjp1bb1370/b1370; zf206Et standard conditions Figure 1 with image from Lasseigne et al., 2021
Mauthner neuron dendrite gjd2a expression absent, abnormal tjp1bb1370/b1370; zf206Et standard conditions Figure 1 with image from Lasseigne et al., 2021
Mauthner neuron dendrite gjd1a expression absent, abnormal tjp1bb1370/b1370; zf206Et standard conditions Figure 1 with image from Lasseigne et al., 2021
Mauthner neuron synapse ab1-tjp1 labeling absent, abnormal tjp1bb1370/b1370; zf206Et standard conditions Figure 1 with image from Lasseigne et al., 2021
Mauthner neuron synapse gjd1a expression absent, abnormal tjp1bb1370/b1370; zf206Et standard conditions Figure 1 with image from Lasseigne et al., 2021
Mauthner neuron synapse gjd2a expression absent, abnormal tjp1bb1370/b1370; zf206Et standard conditions Figure 1 with image from Lasseigne et al., 2021
Mauthner neuron dendrite ab1-tjp1 labeling absent, abnormal tjp1bb1370/b1370; zf206Et standard conditions Figure 1 with image from Lasseigne et al., 2021
Mauthner neuron gap junction ab3-gjd2 labeling absent, abnormal tjp1bb1370/b1370; zf206Et (AB/TU) standard conditions Fig. 1 with image from Marsh et al., 2017
Mauthner neuron gap junction gjd2a expression absent, abnormal tjp1bb1370/b1370; zf206Et (AB/TU) standard conditions Fig. 2 with image from Marsh et al., 2017
spinal cord interneuron gap junction gjd2a expression absent, abnormal tjp1bb1370/b1370; zf206Et (AB/TU) standard conditions Fig. 2 with image from Marsh et al., 2017
Mauthner neuron gap junction assembly decreased occurrence, abnormal tjp1bb1370/b1370; zf206Et (AB/TU) standard conditions Fig. 1 with image from Marsh et al., 2017
spinal cord interneuron gap junction ab3-gjd2 labeling absent, abnormal tjp1bb1370/b1370; zf206Et (AB/TU) standard conditions Fig. 1 with image from Marsh et al., 2017
spinal cord interneuron gap junction ab1-tjp1 labeling absent, abnormal tjp1bb1370/b1370; zf206Et (AB/TU) standard conditions Fig. 2 with image from Marsh et al., 2017
Mauthner neuron gap junction gjd1a expression absent, abnormal tjp1bb1370/b1370; zf206Et (AB/TU) standard conditions Fig. 2 with image from Marsh et al., 2017
Mauthner neuron gap junction-mediated intercellular transport arrested, abnormal tjp1bb1370/b1370; zf206Et (AB/TU) standard conditions Fig. 1 with image from Marsh et al., 2017
spinal cord interneuron gap junction gjd1a expression absent, abnormal tjp1bb1370/b1370; zf206Et (AB/TU) standard conditions Fig. 2 with image from Marsh et al., 2017
spinal cord interneuron gap junction-mediated intercellular transport arrested, abnormal tjp1bb1370/b1370; zf206Et (AB/TU) standard conditions Fig. 1 with image from Marsh et al., 2017
Mauthner neuron gap junction ab1-tjp1 labeling absent, abnormal tjp1bb1370/b1370; zf206Et (AB/TU) standard conditions Fig. 2 with image from Marsh et al., 2017
spinal cord interneuron gap junction assembly decreased occurrence, abnormal tjp1bb1370/b1370; zf206Et (AB/TU) standard conditions Fig. 1 with image from Marsh et al., 2017
Mauthner neuron synapse assembly decreased process quality, abnormal tjp1bb1435/+; tjp1bb1370/+; zf206Et (AB/TU) standard conditions Fig. 1 from Michel et al., 2022
spinal cord interneuron synapse assembly decreased process quality, abnormal tjp1bb1435/+; tjp1bb1370/+; zf206Et (AB/TU) standard conditions Fig. 1 from Michel et al., 2022
Mauthner neuron synapse absent, abnormal tjp1bfh448/+; tjp1bfh449/+ standard conditions Fig. 2 from Shah et al., 2015
Mauthner neuron dendrite gjd2a expression absent, abnormal tjp1afh463/fh463; tjp1bb1370/b1370; zf206Et standard conditions Figure 1-figure supplement 1-source data 1. from Lasseigne et al., 2021
Mauthner neuron synapse tjp1a expression absent, abnormal tjp1afh463/fh463; tjp1bb1370/b1370; zf206Et standard conditions Figure 1-figure supplement 1-source data 1. from Lasseigne et al., 2021
Mauthner neuron dendrite gjd1a expression absent, abnormal tjp1afh463/fh463; tjp1bb1370/b1370; zf206Et standard conditions Figure 1-figure supplement 1-source data 1. from Lasseigne et al., 2021
Mauthner neuron synapse gjd1a expression absent, abnormal tjp1afh463/fh463; tjp1bb1370/b1370; zf206Et standard conditions Figure 1-figure supplement 1-source data 1. from Lasseigne et al., 2021
Mauthner neuron synapse gjd2a expression absent, abnormal tjp1afh463/fh463; tjp1bb1370/b1370; zf206Et standard conditions Figure 1-figure supplement 1-source data 1. from Lasseigne et al., 2021
Mauthner neuron dendrite tjp1a expression absent, abnormal tjp1afh463/fh463; tjp1bb1370/b1370; zf206Et standard conditions Figure 1-figure supplement 1-source data 1. from Lasseigne et al., 2021
spinal cord interneuron gap junction gjd2a expression absent, abnormal tjp1afh463/fh463; tjp1bb1370/b1370; zf206Et (AB/TU) standard conditions Fig. 2 with image from Marsh et al., 2017
spinal cord interneuron gap junction ab1-tjp1 labeling absent, abnormal tjp1afh463/fh463; tjp1bb1370/b1370; zf206Et (AB/TU) standard conditions Fig. 2 with image from Marsh et al., 2017
Mauthner neuron gap junction gjd1a expression absent, abnormal tjp1afh463/fh463; tjp1bb1370/b1370; zf206Et (AB/TU) standard conditions Fig. 2 with image from Marsh et al., 2017
Mauthner neuron gap junction ab1-tjp1 labeling absent, abnormal tjp1afh463/fh463; tjp1bb1370/b1370; zf206Et (AB/TU) standard conditions Fig. 2 with image from Marsh et al., 2017
spinal cord interneuron gap junction gjd1a expression absent, abnormal tjp1afh463/fh463; tjp1bb1370/b1370; zf206Et (AB/TU) standard conditions Fig. 2 with image from Marsh et al., 2017
Mauthner neuron gap junction gjd2a expression absent, abnormal tjp1afh463/fh463; tjp1bb1370/b1370; zf206Et (AB/TU) standard conditions Fig. 2 with image from Marsh et al., 2017
spinal cord neuroepithelial cell ab1-tjp1 labeling absent, abnormal tjp1afh463/fh463; tjp1bb1370/b1370; zf206Et (AB/TU) standard conditions Fig. 2 with image from Marsh et al., 2017
Citations