Morpholino

MO2-tbx5a

ID
ZDB-MRPHLNO-060328-3
Name
MO2-tbx5a
Previous Names
  • MO2-tbx5 (1)
Target
Sequence
5' - CCTGTACGATGTCTACCGTGAGGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tbx5a
Expressed Gene Anatomy Figures
aimp1a Fig. 4 with image,  Fig. S4 with image from Boyle Anderson et al., 2018
bmp4 Fig. 3 with image from Rothschild et al., 2009
camk2b2 Fig. 7 with image from Rothschild et al., 2009
cox6b1 Fig. 3 with image from Boyle Anderson et al., 2018
cryba1l1 Fig. S5 with image from Boyle Anderson et al., 2018
ctsc Fig. S4 with image from Boyle Anderson et al., 2018
hhex Fig. 3 with image from Boyle Anderson et al., 2018
hsp90aa1.2 Fig. 4 with image,  Fig. S4 with image from Boyle Anderson et al., 2018
hspa8b Fig. S4 with image from Boyle Anderson et al., 2018
krt91 Fig. S5 with image from Boyle Anderson et al., 2018
mybphb Fig. S4 with image from Boyle Anderson et al., 2018
myl7 Fig. 3 with image from Rothschild et al., 2009
napbb Fig. S5 with image from Boyle Anderson et al., 2018
ndufa4b Fig. S5 with image from Boyle Anderson et al., 2018
obsl1a Fig. 4 with image,  Fig. S4 with image from Boyle Anderson et al., 2018
phlda2 Fig. 4 with image,  Fig. S4 with image from Boyle Anderson et al., 2018
pvalb2 Fig. S4 with image from Boyle Anderson et al., 2018
ryr1b Fig. 4 with image,  Fig. S4 with image from Boyle Anderson et al., 2018
shha Fig. S3 with image from Steimle et al., 2018
si:dkey-204l11.1 Fig. S5 with image from Boyle Anderson et al., 2018
sox7 Fig. 3 with image from Boyle Anderson et al., 2018
tyrp1b Fig. S5 with image from Boyle Anderson et al., 2018
Phenotype
Phenotype resulting from MO2-tbx5a
Phenotype Fish Figures
head mybphb expression increased amount, abnormal AB + MO2-tbx5a Fig. S4 with image from Boyle Anderson et al., 2018
heart edematous, abnormal WT + MO2-tbx5a Fig. 3 with image from Rothschild et al., 2009
heart physical object quality, abnormal WT + MO2-tbx5a Fig. 7 with image from Rothschild et al., 2009
heart looping arrested, abnormal WT + MO2-tbx5a Fig. 3 with image from Rothschild et al., 2009
immature eye obsl1a expression absent, abnormal AB + MO2-tbx5a Fig. S4 with image from Boyle Anderson et al., 2018
immature eye cryba1l1 expression decreased amount, abnormal AB + MO2-tbx5a Fig. S5 with image from Boyle Anderson et al., 2018
immature eye tyrp1b expression increased amount, abnormal AB + MO2-tbx5a Fig. S5 with image from Boyle Anderson et al., 2018
pectoral fin aplastic, abnormal WT + MO2-tbx5a Fig. 3 with image from Rothschild et al., 2009
pectoral fin physical object quality, abnormal WT + MO2-tbx5a Fig. 7 with image from Rothschild et al., 2009
periderm si:dkey-204l11.1 expression decreased amount, abnormal AB + MO2-tbx5a Fig. S5 with image from Boyle Anderson et al., 2018
primordial vasculature hhex expression decreased amount, abnormal AB + MO2-tbx5a Fig. 3 with image from Boyle Anderson et al., 2018
primordial vasculature hhex expression spatial pattern, abnormal AB + MO2-tbx5a Fig. 3 with image from Boyle Anderson et al., 2018
primordial vasculature sox7 expression spatial pattern, abnormal AB + MO2-tbx5a Fig. 3 with image from Boyle Anderson et al., 2018
pronephros cox6b1 expression increased amount, abnormal AB + MO2-tbx5a Fig. 3 with image from Boyle Anderson et al., 2018
pronephros anatomical region cox6b1 expression mislocalised, abnormal AB + MO2-tbx5a Fig. 3 with image from Boyle Anderson et al., 2018
somite aimp1a expression decreased amount, abnormal AB + MO2-tbx5a Fig. 4 with image,  Fig. S4 with image from Boyle Anderson et al., 2018
somite hspa8b expression increased amount, abnormal AB + MO2-tbx5a Fig. S4 with image from Boyle Anderson et al., 2018
somite obsl1a expression increased amount, abnormal AB + MO2-tbx5a Fig. 4 with image,  Fig. S4 with image from Boyle Anderson et al., 2018
somite hsp90aa1.2 expression increased amount, abnormal AB + MO2-tbx5a Fig. 4 with image,  Fig. S4 with image from Boyle Anderson et al., 2018
somite mybphb expression increased amount, abnormal AB + MO2-tbx5a Fig. S4 with image from Boyle Anderson et al., 2018
somite hspa8b expression increased distribution, abnormal AB + MO2-tbx5a Fig. S4 with image from Boyle Anderson et al., 2018
somite medial side ctsc expression increased distribution, abnormal AB + MO2-tbx5a Fig. S4 with image from Boyle Anderson et al., 2018
whole organism anterior side phlda2 expression decreased amount, abnormal AB + MO2-tbx5a Fig. S4 with image from Boyle Anderson et al., 2018
yolk napbb expression mislocalised, abnormal AB + MO2-tbx5a Fig. S5 with image from Boyle Anderson et al., 2018
Phenotype of all Fish created by or utilizing MO2-tbx5a
Phenotype Fish Conditions Figures
primordial vasculature hhex expression decreased amount, abnormal AB + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
primordial vasculature sox7 expression spatial pattern, abnormal AB + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
somite medial side ctsc expression increased distribution, abnormal AB + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
head mybphb expression increased amount, abnormal AB + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
immature eye tyrp1b expression increased amount, abnormal AB + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
somite hsp90aa1.2 expression increased amount, abnormal AB + MO2-tbx5a standard conditions Fig. 4 with image,  Fig. S4 with image from Boyle Anderson et al., 2018
immature eye cryba1l1 expression decreased amount, abnormal AB + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
primordial vasculature hhex expression spatial pattern, abnormal AB + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
somite hspa8b expression increased distribution, abnormal AB + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
somite mybphb expression increased amount, abnormal AB + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
pronephros cox6b1 expression increased amount, abnormal AB + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
periderm si:dkey-204l11.1 expression decreased amount, abnormal AB + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
somite obsl1a expression increased amount, abnormal AB + MO2-tbx5a standard conditions Fig. 4 with image,  Fig. S4 with image from Boyle Anderson et al., 2018
somite aimp1a expression decreased amount, abnormal AB + MO2-tbx5a standard conditions Fig. 4 with image,  Fig. S4 with image from Boyle Anderson et al., 2018
whole organism anterior side phlda2 expression decreased amount, abnormal AB + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
pronephros anatomical region cox6b1 expression mislocalised, abnormal AB + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
yolk napbb expression mislocalised, abnormal AB + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
somite hspa8b expression increased amount, abnormal AB + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
immature eye obsl1a expression absent, abnormal AB + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
heart edematous, abnormal WT + MO2-tbx5a standard conditions Fig. 3 with image from Rothschild et al., 2009
pectoral fin aplastic, abnormal WT + MO2-tbx5a standard conditions Fig. 3 with image from Rothschild et al., 2009
pectoral fin physical object quality, abnormal WT + MO2-tbx5a standard conditions Fig. 7 with image from Rothschild et al., 2009
heart looping arrested, abnormal WT + MO2-tbx5a standard conditions Fig. 3 with image from Rothschild et al., 2009
heart physical object quality, abnormal WT + MO2-tbx5a standard conditions Fig. 7 with image from Rothschild et al., 2009
primordial vasculature sox7 expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
primordial vasculature sox7 expression spatial pattern, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
somite medial side ctsc expression increased distribution, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
somite pvalb2 expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
periderm krt91 expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
somite phlda2 expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with image,  Fig. S4 with image from Boyle Anderson et al., 2018
somite hsp90aa1.2 expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with image,  Fig. S4 with image from Boyle Anderson et al., 2018
immature eye tyrp1b expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
somite hspa8b expression increased distribution, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
tail bud napbb expression increased distribution, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
pronephros cox6b1 expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
trunk anterior region mybphb expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
periderm si:dkey-204l11.1 expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
somite ryr1b expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with image,  Fig. S4 with image from Boyle Anderson et al., 2018
whole organism posterior region mybphb expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
somite obsl1a expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with image,  Fig. S4 with image from Boyle Anderson et al., 2018
somite hsp90aa1.2 expression mislocalised, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with image,  Fig. S4 with image from Boyle Anderson et al., 2018
immature eye cryba1l1 expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
yolk syncytial layer ndufa4b expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
somite aimp1a expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with image,  Fig. S4 with image from Boyle Anderson et al., 2018
whole organism phlda2 expression decreased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
somite decreased size, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 4 with image from Boyle Anderson et al., 2018
whole organism napbb expression mislocalised, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
pronephros anatomical region cox6b1 expression mislocalised, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
yolk napbb expression mislocalised, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
primordial vasculature hhex expression decreased distribution, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
immature eye tyrp1b expression decreased distribution, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S5 with image from Boyle Anderson et al., 2018
somite mybphb expression spatial pattern, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
somite hspa8b expression increased amount, abnormal AB + MO1-tbx5b + MO2-tbx5a standard conditions Fig. S4 with image from Boyle Anderson et al., 2018
intersegmental vessel increased branchiness, abnormal y1Tg + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
subintestinal vein decreased size, abnormal y1Tg + MO1-tbx5b + MO2-tbx5a standard conditions Fig. 3 with image from Boyle Anderson et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.