Morpholino

MO1-coasy

ID
ZDB-MRPHLNO-171219-1
Name
MO1-coasy
Previous Names
None
Target
Sequence
5' - ACCACCTGAACATAGACATACAGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-coasy
Expressed Gene Anatomy Figures
bmpr1aa Fig. 8 with image from Khatri et al., 2016
bmpr1ab Fig. 8 with image from Khatri et al., 2016
bmpr1ba Fig. 8 with image from Khatri et al., 2016
bmpr1bb Fig. 8 with image from Khatri et al., 2016
bmpr2a Fig. 8 with image from Khatri et al., 2016
bmpr2b Fig. 8 with image from Khatri et al., 2016
gata2a Fig. 5 with image from Khatri et al., 2016
myod1 Fig. 7 with image from Khatri et al., 2016
neurod1 Fig. 4 with image from Khatri et al., 2016
neurog1 Fig. 5 with image from Khatri et al., 2016
pax2a Fig. 5 with image from Khatri et al., 2016
tbxta Fig. 7 with image from Khatri et al., 2016
Phenotype
Phenotype resulting from MO1-coasy
Phenotype Fish Figures
anal fin decreased size, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
anal fin hypoplastic, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
anatomical structure EGFP expression decreased distribution, abnormal mw29Tg + MO1-coasy Fig. 8 with image from Khatri et al., 2016
BMP signaling pathway decreased process quality, abnormal sd2Tg; y1Tg + MO1-coasy Fig. 8 with image from Khatri et al., 2016
brain morphology, abnormal AB + MO1-coasy Fig. 4 with image from Khatri et al., 2016
brain cell death increased process quality, abnormal AB + MO1-coasy Fig. S10 with image from Khatri et al., 2016
brain development process quality, abnormal AB + MO1-coasy Fig. 2 with image from Khatri et al., 2016
diencephalon neurog1 expression decreased distribution, abnormal AB + MO1-coasy Fig. 5 with image from Khatri et al., 2016
diencephalon gata2a expression decreased distribution, abnormal AB + MO1-coasy Fig. 5 with image from Khatri et al., 2016
eye EGFP expression decreased distribution, abnormal mw29Tg + MO1-coasy Fig. 8 with image from Khatri et al., 2016
head edematous, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
head development disrupted, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
hindbrain gata2a expression decreased distribution, abnormal AB + MO1-coasy Fig. 5 with image from Khatri et al., 2016
hindbrain neurog1 expression decreased distribution, abnormal AB + MO1-coasy Fig. 5 with image from Khatri et al., 2016
hindbrain morphology, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
intersegmental vessel hypoplastic, abnormal sd2Tg; y1Tg + MO1-coasy Fig. 6 with image from Khatri et al., 2016
lateral line ganglion neurod1 expression decreased distribution, abnormal AB + MO1-coasy Fig. 4 with image from Khatri et al., 2016
midbrain morphology, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
midbrain hindbrain boundary neurod1 expression decreased distribution, abnormal AB + MO1-coasy Fig. 4 with image from Khatri et al., 2016
midbrain hindbrain boundary neural rod pax2a expression decreased distribution, abnormal AB + MO1-coasy Fig. 5 with image from Khatri et al., 2016
notochord tbxta expression decreased distribution, abnormal AB + MO1-coasy Fig. 7 with image from Khatri et al., 2016
nucleate erythrocyte decreased amount, abnormal sd2Tg; y1Tg + MO1-coasy Fig. 6 with image from Khatri et al., 2016
post-vent region curved, abnormal AB + MO1-coasy Fig. 1 with image,  Fig. 2 with image from Khatri et al., 2016
post-vent region edematous, abnormal AB + MO1-coasy Fig. 1 with image,  Fig. 2 with image from Khatri et al., 2016
post-vent region kinked, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
post-vent region morphology, abnormal AB + MO1-coasy Fig. 4 with image from Khatri et al., 2016
post-vent region cell death increased process quality, abnormal AB + MO1-coasy Fig. S10 with image from Khatri et al., 2016
segmental plate myod1 expression spatial pattern, abnormal AB + MO1-coasy Fig. 7 with image from Khatri et al., 2016
somite EGFP expression decreased distribution, abnormal mw29Tg + MO1-coasy Fig. 8 with image from Khatri et al., 2016
somite shape, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
somite border structure, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
somite development process quality, abnormal AB + MO1-coasy Fig. 2 with image from Khatri et al., 2016
spinal cord neuron neurog1 expression decreased distribution, abnormal AB + MO1-coasy Fig. 5 with image from Khatri et al., 2016
tail bud tbxta expression decreased distribution, abnormal AB + MO1-coasy Fig. 7 with image from Khatri et al., 2016
tegmentum neurog1 expression decreased distribution, abnormal AB + MO1-coasy Fig. 5 with image from Khatri et al., 2016
telencephalon neurog1 expression decreased distribution, abnormal AB + MO1-coasy Fig. 5 with image from Khatri et al., 2016
telencephalon neurod1 expression decreased distribution, abnormal AB + MO1-coasy Fig. 4 with image from Khatri et al., 2016
trunk decreased thickness, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
vasculature development disrupted, abnormal sd2Tg; y1Tg + MO1-coasy Fig. 6 with image from Khatri et al., 2016
vasculature development process quality, abnormal sd2Tg; y1Tg + MO1-coasy Fig. 6 with image from Khatri et al., 2016
whole organism bmpr1aa expression decreased amount, abnormal mw29Tg + MO1-coasy Fig. 8 with image from Khatri et al., 2016
whole organism bmpr2a expression decreased amount, abnormal mw29Tg + MO1-coasy Fig. 8 with image from Khatri et al., 2016
whole organism bmpr1ab expression decreased amount, abnormal mw29Tg + MO1-coasy Fig. 8 with image from Khatri et al., 2016
whole organism Ab3-smad5 labeling decreased amount, abnormal mw29Tg + MO1-coasy Fig. 8 with image from Khatri et al., 2016
whole organism bmpr1bb expression decreased amount, abnormal mw29Tg + MO1-coasy Fig. 8 with image from Khatri et al., 2016
whole organism bmpr1ba expression decreased amount, abnormal mw29Tg + MO1-coasy Fig. 8 with image from Khatri et al., 2016
whole organism wholly dorsalized, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
yolk increased size, abnormal AB + MO1-coasy Fig. 1 with image from Khatri et al., 2016
Phenotype of all Fish created by or utilizing MO1-coasy
Phenotype Fish Conditions Figures
yolk increased size, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
trunk decreased thickness, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
lateral line ganglion neurod1 expression spatial pattern, ameliorated AB + MO1-coasy chemical treatment by environment: coenzyme A Fig. 4 with image from Khatri et al., 2016
telencephalon neurog1 expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 5 with image from Khatri et al., 2016
spinal cord neuron neurog1 expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 5 with image from Khatri et al., 2016
hindbrain neurog1 expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 5 with image from Khatri et al., 2016
head edematous, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
brain morphology, ameliorated AB + MO1-coasy chemical treatment by injection: coenzyme A Fig. 4 with image from Khatri et al., 2016
hindbrain gata2a expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 5 with image from Khatri et al., 2016
brain cell death increased process quality, abnormal AB + MO1-coasy control Fig. S10 with image from Khatri et al., 2016
post-vent region morphology, abnormal AB + MO1-coasy standard conditions Fig. 4 with image from Khatri et al., 2016
brain morphology, ameliorated AB + MO1-coasy chemical treatment by environment: coenzyme A Fig. 4 with image from Khatri et al., 2016
telencephalon neurod1 expression spatial pattern, ameliorated AB + MO1-coasy chemical treatment by injection: coenzyme A Fig. 4 with image from Khatri et al., 2016
post-vent region morphology, abnormal AB + MO1-coasy chemical treatment by injection: coenzyme A Fig. 4 with image from Khatri et al., 2016
post-vent region curved, abnormal AB + MO1-coasy standard conditions Fig. 1 with image,  Fig. 2 with image from Khatri et al., 2016
lateral line ganglion neurod1 expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 4 with image from Khatri et al., 2016
somite development process quality, ameliorated AB + MO1-coasy chemical treatment by environment: coenzyme A Fig. 2 with image from Khatri et al., 2016
lateral line ganglion neurod1 expression spatial pattern, ameliorated AB + MO1-coasy chemical treatment by injection: coenzyme A Fig. 4 with image from Khatri et al., 2016
tail bud tbxta expression spatial pattern, ameliorated AB + MO1-coasy chemical treatment by environment: coenzyme A Fig. 7 with image from Khatri et al., 2016
diencephalon neurog1 expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 5 with image from Khatri et al., 2016
post-vent region morphology, ameliorated AB + MO1-coasy chemical treatment by environment: coenzyme A Fig. 2 with image,  Fig. 4 with image from Khatri et al., 2016
midbrain morphology, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
midbrain hindbrain boundary neurod1 expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 4 with image from Khatri et al., 2016
tail bud tbxta expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 7 with image from Khatri et al., 2016
brain development process quality, ameliorated AB + MO1-coasy chemical treatment by environment: coenzyme A Fig. 2 with image from Khatri et al., 2016
tegmentum neurog1 expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 5 with image from Khatri et al., 2016
somite border structure, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
anal fin decreased size, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
notochord tbxta expression spatial pattern, ameliorated AB + MO1-coasy chemical treatment by environment: coenzyme A Fig. 7 with image from Khatri et al., 2016
midbrain hindbrain boundary neurod1 expression spatial pattern, ameliorated AB + MO1-coasy chemical treatment by injection: coenzyme A Fig. 4 with image from Khatri et al., 2016
diencephalon gata2a expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 5 with image from Khatri et al., 2016
telencephalon neurod1 expression spatial pattern, ameliorated AB + MO1-coasy chemical treatment by environment: coenzyme A Fig. 4 with image from Khatri et al., 2016
telencephalon neurod1 expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 4 with image from Khatri et al., 2016
post-vent region cell death increased process quality, abnormal AB + MO1-coasy control Fig. S10 with image from Khatri et al., 2016
segmental plate myod1 expression spatial pattern, ameliorated AB + MO1-coasy chemical treatment by environment: coenzyme A Fig. 7 with image from Khatri et al., 2016
post-vent region kinked, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
brain development process quality, abnormal AB + MO1-coasy standard conditions Fig. 2 with image from Khatri et al., 2016
post-vent region edematous, abnormal AB + MO1-coasy standard conditions Fig. 1 with image,  Fig. 2 with image from Khatri et al., 2016
midbrain hindbrain boundary neurod1 expression spatial pattern, ameliorated AB + MO1-coasy chemical treatment by environment: coenzyme A Fig. 4 with image from Khatri et al., 2016
segmental plate myod1 expression spatial pattern, abnormal AB + MO1-coasy standard conditions Fig. 7 with image from Khatri et al., 2016
midbrain hindbrain boundary neural rod pax2a expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 5 with image from Khatri et al., 2016
whole organism wholly dorsalized, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
somite shape, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
hindbrain morphology, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
notochord tbxta expression decreased distribution, abnormal AB + MO1-coasy standard conditions Fig. 7 with image from Khatri et al., 2016
somite development process quality, abnormal AB + MO1-coasy standard conditions Fig. 2 with image from Khatri et al., 2016
head development disrupted, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
brain morphology, abnormal AB + MO1-coasy standard conditions Fig. 4 with image from Khatri et al., 2016
anal fin hypoplastic, abnormal AB + MO1-coasy standard conditions Fig. 1 with image from Khatri et al., 2016
anatomical structure EGFP expression spatial pattern, ameliorated mw29Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 8 with image from Khatri et al., 2016
whole organism bmpr1aa expression decreased amount, abnormal mw29Tg + MO1-coasy standard conditions Fig. 8 with image from Khatri et al., 2016
somite EGFP expression decreased distribution, abnormal mw29Tg + MO1-coasy standard conditions Fig. 8 with image from Khatri et al., 2016
whole organism bmpr1ab expression decreased amount, abnormal mw29Tg + MO1-coasy standard conditions Fig. 8 with image from Khatri et al., 2016
whole organism bmpr1bb expression decreased amount, abnormal mw29Tg + MO1-coasy standard conditions Fig. 8 with image from Khatri et al., 2016
anatomical structure EGFP expression decreased distribution, abnormal mw29Tg + MO1-coasy standard conditions Fig. 8 with image from Khatri et al., 2016
whole organism bmpr1ab expression amount, ameliorated mw29Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 8 with image from Khatri et al., 2016
whole organism bmpr1bb expression amount, ameliorated mw29Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 8 with image from Khatri et al., 2016
eye EGFP expression spatial pattern, ameliorated mw29Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 8 with image from Khatri et al., 2016
whole organism Ab3-smad5 labeling decreased amount, abnormal mw29Tg + MO1-coasy standard conditions Fig. 8 with image from Khatri et al., 2016
whole organism bmpr2a expression amount, ameliorated mw29Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 8 with image from Khatri et al., 2016
whole organism bmpr2a expression decreased amount, abnormal mw29Tg + MO1-coasy standard conditions Fig. 8 with image from Khatri et al., 2016
whole organism bmpr1ba expression decreased amount, abnormal mw29Tg + MO1-coasy standard conditions Fig. 8 with image from Khatri et al., 2016
whole organism Ab3-smad5 labeling amount, ameliorated mw29Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 8 with image from Khatri et al., 2016
somite EGFP expression spatial pattern, ameliorated mw29Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 8 with image from Khatri et al., 2016
whole organism bmpr1ba expression amount, ameliorated mw29Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 8 with image from Khatri et al., 2016
eye EGFP expression decreased distribution, abnormal mw29Tg + MO1-coasy standard conditions Fig. 8 with image from Khatri et al., 2016
BMP signaling pathway process quality, ameliorated sd2Tg; y1Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 8 with image from Khatri et al., 2016
vasculature development process quality, ameliorated sd2Tg; y1Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 6 with image from Khatri et al., 2016
intersegmental vessel physical object quality, ameliorated sd2Tg; y1Tg + MO1-coasy chemical treatment by environment: coenzyme A Fig. 6 with image from Khatri et al., 2016
nucleate erythrocyte decreased amount, abnormal sd2Tg; y1Tg + MO1-coasy standard conditions Fig. 6 with image from Khatri et al., 2016
vasculature development process quality, abnormal sd2Tg; y1Tg + MO1-coasy standard conditions Fig. 6 with image from Khatri et al., 2016
BMP signaling pathway decreased process quality, abnormal sd2Tg; y1Tg + MO1-coasy standard conditions Fig. 8 with image from Khatri et al., 2016
vasculature development disrupted, abnormal sd2Tg; y1Tg + MO1-coasy standard conditions Fig. 6 with image from Khatri et al., 2016
intersegmental vessel hypoplastic, abnormal sd2Tg; y1Tg + MO1-coasy standard conditions Fig. 6 with image from Khatri et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.