Morpholino

MO1-six7

ID

ZDB-MRPHLNO-071205-1

Name

MO1-six7

Previous Names

None

Target

six7 (1)

Sequence

5' - CCAACGGCATTCCAGTGTGAGTAAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This MO targets the 5' UTR of six7.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-six7

Expressed Gene	Anatomy	Figures
egr2b	hindbrain	Fig. 1 from Inbal et al., 2007
emx3	forebrain	Fig. 1 from Inbal et al., 2007
gsc	prechordal plate	Fig. S4 from Inbal et al., 2007
kctd12.1	habenula	Fig. 1 from Inbal et al., 2007
lft1	epithalamus lateral plate mesoderm notochord prechordal plate	Fig. 2 , Fig. 3 , Fig. 5 , Fig. S4 from Inbal et al., 2007
ndr2	epithalamus prechordal plate	Fig. 2 , Fig. S4 from Inbal et al., 2007
noto	epiphysis	Fig. 2 from Inbal et al., 2007
otx5	epiphysis parapineal organ	Fig. 1 from Inbal et al., 2007
pax2a	midbrain hindbrain boundary optic stalk	Fig. 1 from Inbal et al., 2007
pitx2	epithalamus lateral plate mesoderm prechordal plate	Fig. 2 , Fig. S4 from Inbal et al., 2007
six3b	forebrain immature eye notochord	Fig. 3 from Inbal et al., 2007
tdgf1	epiphysis	Fig. 2 from Inbal et al., 2007

Phenotype

Phenotype resulting from MO1-six7

Phenotype	Fish	Figures
embryonic retina morphogenesis in camera-type eye disrupted, abnormal	q16aTg; q16bTg + MO1-six7	Fig. 8 from Saade et al., 2013
retinal ganglion cell layer apoptotic process increased occurrence, abnormal	WT + MO1-six7	Fig. 3 from Sotolongo-Lopez et al., 2016
retinal inner nuclear layer apoptotic process increased occurrence, abnormal	WT + MO1-six7	Fig. 3 from Sotolongo-Lopez et al., 2016
retinal outer nuclear layer cell population proliferation temporally extended, abnormal	WT + MO1-six7	Fig. 3 from Sotolongo-Lopez et al., 2016
retinal outer nuclear layer retinal rod cell increased amount, abnormal	q16aTg; q16bTg + MO1-six7	Fig. 8 from Saade et al., 2013
retinal rod cell increased amount, abnormal	WT + MO1-six7	Fig. 2 , Fig. 3 from Sotolongo-Lopez et al., 2016
retinal rod cell cell population proliferation increased occurrence, abnormal	WT + MO1-six7	Fig. 3 from Sotolongo-Lopez et al., 2016

Phenotype of all Fish created by or utilizing MO1-six7

Phenotype	Fish	Conditions	Figures
retinal rod cell increased amount, abnormal	WT + MO1-six7	standard conditions	Fig. 2 , Fig. 3 from Sotolongo-Lopez et al., 2016
retinal ganglion cell layer apoptotic process increased occurrence, abnormal	WT + MO1-six7	standard conditions	Fig. 3 from Sotolongo-Lopez et al., 2016
retinal inner nuclear layer apoptotic process increased occurrence, abnormal	WT + MO1-six7	standard conditions	Fig. 3 from Sotolongo-Lopez et al., 2016
retinal rod cell cell population proliferation increased occurrence, abnormal	WT + MO1-six7	standard conditions	Fig. 3 from Sotolongo-Lopez et al., 2016
retinal outer nuclear layer cell population proliferation temporally extended, abnormal	WT + MO1-six7	standard conditions	Fig. 3 from Sotolongo-Lopez et al., 2016
embryonic retina morphogenesis in camera-type eye disrupted, abnormal	q16aTg; q16bTg + MO1-six7	standard conditions	Fig. 8 from Saade et al., 2013
retinal outer nuclear layer retinal rod cell increased amount, abnormal	q16aTg; q16bTg + MO1-six7	standard conditions	Fig. 8 from Saade et al., 2013
eye aplastic, abnormal	six3b^vu87/vu87 + MO1-six7	standard conditions	Fig. 1 from Geng et al., 2008
parapineal organ right side of epiphysis, abnormal	six3b^vu87/vu87 + MO1-six7 (AB)	standard conditions	Fig. 1 from Inbal et al., 2007
optic stalk decreased size, abnormal	six3b^vu87/vu87 + MO1-six7 (AB)	standard conditions	Fig. 1 from Inbal et al., 2007
habenula asymmetrical, abnormal	six3b^vu87/vu87 + MO1-six7 (AB)	standard conditions	Fig. 1 from Inbal et al., 2007
eye aplastic, abnormal	six3b^vu87/vu87 + MO1-six7 (AB)	standard conditions	Fig. 1 from Inbal et al., 2007
parapineal organ mislocalised anteriorly, abnormal	six3b^vu87/vu87 + MO1-six7 (AB)	standard conditions	Fig. 1 from Inbal et al., 2007

Citations