Morpholino

MO1-dnajb6b

ID
ZDB-MRPHLNO-140722-5
Name
MO1-dnajb6b
Previous Names
None
Target
Sequence
5' - AAATATCCAATACCATCTGACAGGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dnajb6b
Expressed Gene Anatomy Figures
dnajb6b Fig. S5 from Sarparanta et al., 2012
Phenotype
Phenotype resulting from MO1-dnajb6b
Phenotype Fish Figures
autophagy increased occurrence, abnormal WT + MO1-dnajb6b Fig. 3 with image from Bührdel et al., 2015
locomotion disrupted, abnormal WT + MO1-dnajb6b Fig. 2 with image from Bührdel et al., 2015
muscle morphology, abnormal WT + MO1-dnajb6b Fig. 2 from Sarparanta et al., 2012
myotome myofibril detached from vertical myoseptum, abnormal WT + MO1-dnajb6b Fig. 2,  Fig. S5 from Sarparanta et al., 2012
pericardium edematous, abnormal WT + MO1-dnajb6b Fig. S4 with image from Bührdel et al., 2015
skeletal muscle refractivity, abnormal WT + MO1-dnajb6b Fig. 3 with image,  Fig. S4 with image from Bührdel et al., 2015
skeletal muscle nucleus circular, abnormal WT + MO1-dnajb6b Fig. 3 with image from Bührdel et al., 2015
skeletal muscle sarcomere disorganized, abnormal WT + MO1-dnajb6b Fig. 3 with image from Bührdel et al., 2015
slow muscle cell detached from vertical myoseptum, abnormal WT + MO1-dnajb6b Fig. 2 from Sarparanta et al., 2012
thigmotaxis disrupted, abnormal WT + MO1-dnajb6b Fig. 2 with image from Bührdel et al., 2015
trunk curved, abnormal WT + MO1-dnajb6b Fig. S4 with image from Bührdel et al., 2015
whole organism decreased mobility, abnormal WT + MO1-dnajb6b Fig. 2 with image from Bührdel et al., 2015
Phenotype of all Fish created by or utilizing MO1-dnajb6b
Phenotype Fish Conditions Figures
autophagy increased occurrence, abnormal WT + MO1-dnajb6b standard conditions Fig. 3 with image from Bührdel et al., 2015
skeletal muscle sarcomere disorganized, abnormal WT + MO1-dnajb6b standard conditions Fig. 3 with image from Bührdel et al., 2015
thigmotaxis disrupted, abnormal WT + MO1-dnajb6b standard conditions Fig. 2 with image from Bührdel et al., 2015
pericardium edematous, abnormal WT + MO1-dnajb6b standard conditions Fig. S4 with image from Bührdel et al., 2015
skeletal muscle refractivity, abnormal WT + MO1-dnajb6b standard conditions Fig. 3 with image,  Fig. S4 with image from Bührdel et al., 2015
whole organism decreased mobility, abnormal WT + MO1-dnajb6b standard conditions Fig. 2 with image from Bührdel et al., 2015
trunk curved, abnormal WT + MO1-dnajb6b standard conditions Fig. S4 with image from Bührdel et al., 2015
skeletal muscle nucleus circular, abnormal WT + MO1-dnajb6b standard conditions Fig. 3 with image from Bührdel et al., 2015
slow muscle cell detached from vertical myoseptum, abnormal WT + MO1-dnajb6b standard conditions Fig. 2 from Sarparanta et al., 2012
locomotion disrupted, abnormal WT + MO1-dnajb6b standard conditions Fig. 2 with image from Bührdel et al., 2015
muscle morphology, abnormal WT + MO1-dnajb6b standard conditions Fig. 2 from Sarparanta et al., 2012
myotome myofibril detached from vertical myoseptum, abnormal WT + MO1-dnajb6b standard conditions Fig. 2,  Fig. S5 from Sarparanta et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.