Morpholino

MO1-pacsin3

ID
ZDB-MRPHLNO-100223-1
Name
MO1-pacsin3
Previous Names
None
Target
Sequence
5' - GCAGATCACCGTTGGAAGACATTTTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
targeted to the initiation codon of pacsin3
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pacsin3
Expressed Gene Anatomy Figures
myod1 Fig. 5 with image from Edeling et al., 2009
ptch2 Fig. 5 with image from Edeling et al., 2009
shha Fig. 5 with image from Edeling et al., 2009
tbxta Fig. 4 with image from Edeling et al., 2009
Phenotype
Phenotype resulting from MO1-pacsin3
Phenotype Fish Figures
extension aplastic, abnormal WT + MO1-pacsin3 Fig. 4 with image from Edeling et al., 2009
notochord coiled, abnormal WT + MO1-pacsin3 Fig. 4 with image from Edeling et al., 2009
notochord increased width, abnormal WT + MO1-pacsin3 Fig. 5 with image from Edeling et al., 2009
notochord malformed, abnormal WT + MO1-pacsin3 Fig. 4 with image,  Fig. 6 with image from Edeling et al., 2009
notochord poorly differentiated, abnormal WT + MO1-pacsin3 Fig. 5 with image,  Fig. 6 with image from Edeling et al., 2009
notochord undulate, abnormal WT + MO1-pacsin3 Fig. 5 with image from Edeling et al., 2009
notochord vacuole decreased size, abnormal WT + MO1-pacsin3 Fig. 5 with image from Edeling et al., 2009
notochord vacuole increased amount, abnormal WT + MO1-pacsin3 Fig. 5 with image from Edeling et al., 2009
notochord cell differentiation process quality, abnormal WT + MO1-pacsin3 Fig. 5 with image,  Fig. 6 with image from Edeling et al., 2009
notochord formation process quality, abnormal WT + MO1-pacsin3 Fig. 4 with image,  Fig. 6 with image from Edeling et al., 2009
post-vent region bent, abnormal WT + MO1-pacsin3 Fig. 4 with image from Edeling et al., 2009
post-vent region decreased length, abnormal WT + MO1-pacsin3 Fig. 4 with image from Edeling et al., 2009
somite increased width, abnormal WT + MO1-pacsin3 Fig. 5 with image from Edeling et al., 2009
Phenotype of all Fish created by or utilizing MO1-pacsin3
Phenotype Fish Conditions Figures
notochord formation process quality, abnormal WT + MO1-pacsin3 standard conditions Fig. 4 with image,  Fig. 6 with image from Edeling et al., 2009
notochord undulate, abnormal WT + MO1-pacsin3 standard conditions Fig. 5 with image from Edeling et al., 2009
notochord cell differentiation process quality, abnormal WT + MO1-pacsin3 standard conditions Fig. 5 with image,  Fig. 6 with image from Edeling et al., 2009
notochord malformed, abnormal WT + MO1-pacsin3 standard conditions Fig. 4 with image,  Fig. 6 with image from Edeling et al., 2009
post-vent region decreased length, abnormal WT + MO1-pacsin3 standard conditions Fig. 4 with image from Edeling et al., 2009
notochord vacuole decreased size, abnormal WT + MO1-pacsin3 standard conditions Fig. 5 with image from Edeling et al., 2009
notochord coiled, abnormal WT + MO1-pacsin3 standard conditions Fig. 4 with image from Edeling et al., 2009
somite increased width, abnormal WT + MO1-pacsin3 standard conditions Fig. 5 with image from Edeling et al., 2009
notochord vacuole increased amount, abnormal WT + MO1-pacsin3 standard conditions Fig. 5 with image from Edeling et al., 2009
notochord poorly differentiated, abnormal WT + MO1-pacsin3 standard conditions Fig. 5 with image,  Fig. 6 with image from Edeling et al., 2009
notochord increased width, abnormal WT + MO1-pacsin3 standard conditions Fig. 5 with image from Edeling et al., 2009
extension aplastic, abnormal WT + MO1-pacsin3 standard conditions Fig. 4 with image from Edeling et al., 2009
post-vent region bent, abnormal WT + MO1-pacsin3 standard conditions Fig. 4 with image from Edeling et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.