Morpholino

MO1-cdx1b

ID
ZDB-MRPHLNO-080707-1
Name
MO1-cdx1b
Previous Names
None
Target
Sequence
5' - CATTTTTTCTGGTGGCTCCAGTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino that targets cdx1b.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdx1b
Expressed Gene Anatomy Figures
agr2 Fig. 3 with image from Chen et al., 2009
cp Fig. 8 with image from Cheng et al., 2008
fabp1a Fig. 3 with image from Cheng et al., 2008
fabp2 Fig. 3 with image from Cheng et al., 2008
fgf3 Fig. 5 with image from Cheng et al., 2008
foxa2 Fig. 4 with image from Cheng et al., 2008
gata5 Fig. 4 with image,  Fig. S5 with image from Cheng et al., 2008
gata6 Fig. S5 with image from Cheng et al., 2008
gsc Fig. 5 with image from Cheng et al., 2008
hnf4a Fig. S5 with image from Cheng et al., 2008
ins Fig. 3 with image from Cheng et al., 2008
lft1 Fig. 7 with image,  Table 1 from Wu et al., 2020
mixl1 Fig. S4 with image from Cheng et al., 2008
ndr1 Fig. S4 with image from Cheng et al., 2008
ndr2 Fig. 7 with image,  Table 1 from Wu et al., 2020
Fig. S4 with image from Cheng et al., 2008
nkx2.2a Fig. 4 with image from Chen et al., 2009
pitx2 Table 1 from Wu et al., 2020
prss1 Fig. 3 with image from Cheng et al., 2008
shha Fig. 2 with image from Cheng et al., 2008
slc15a1b Fig. 5 with image from Chen et al., 2009
sox17 Fig. 4 with image from Cheng et al., 2008
sox32 Fig. 4 with image from Cheng et al., 2008
tbxta Fig. 5 with image from Cheng et al., 2008
tdgf1 Fig. S4 with image from Cheng et al., 2008
Phenotype
Phenotype resulting from MO1-cdx1b
Phenotype Fish Figures
basal plate midbrain region decreased size, abnormal WT + MO1-cdx1b Fig. 2 with image from Cheng et al., 2008
determination of left/right symmetry disrupted, abnormal WT + MO1-cdx1b Fig. 3 with image from Cheng et al., 2008
diencephalon dorsal region ndr2 expression absent, abnormal AB + MO1-cdx1b Table 1 from Wu et al., 2020
diencephalon dorsal region pitx2 expression absent, abnormal AB + MO1-cdx1b Table 1 from Wu et al., 2020
diencephalon dorsal region lft1 expression absent, abnormal AB + MO1-cdx1b Table 1 from Wu et al., 2020
diencephalon dorsal region lft1 expression mislocalised, abnormal AB + MO1-cdx1b Fig. 7 with image from Wu et al., 2020
digestive tract morphogenesis disrupted, abnormal WT + MO1-cdx1b Fig. S5 with image from Cheng et al., 2008
endocrine pancreas decreased size, abnormal WT + MO1-cdx1b Fig. 3 with image from Cheng et al., 2008
endodermal cell decreased amount, abnormal WT + MO1-cdx1b Fig. 4 with image from Cheng et al., 2008
enterocyte cuboid, abnormal WT + MO1-cdx1b Fig. 6 with image from Chen et al., 2009
enterocyte morphology, abnormal WT + MO1-cdx1b Fig. 6 with image from Chen et al., 2009
enterocyte microvillus decreased length, abnormal WT + MO1-cdx1b Fig. 6 with image from Chen et al., 2009
enteroendocrine cell decreased amount, abnormal WT + MO1-cdx1b Fig. 4 with image from Chen et al., 2009
enteroendocrine cell nkx2.2a expression decreased amount, abnormal WT + MO1-cdx1b Fig. 4 with image from Chen et al., 2009
exocrine pancreas decreased size, abnormal WT + MO1-cdx1b Fig. 3 with image,  Fig. S5 with image from Cheng et al., 2008
eye decreased distance eye, abnormal WT + MO1-cdx1b Fig. 2 with image from Cheng et al., 2008
goblet cell secretory granule decreased amount, abnormal WT + MO1-cdx1b Fig. 6 with image from Chen et al., 2009
heart shape, abnormal WT + MO1-cdx1b Fig. 2 with image from Chen et al., 2009
heart looping disrupted, abnormal WT + MO1-cdx1b Fig. 2 with image from Chen et al., 2009
Fig. 2 with image from Cheng et al., 2008
hypothalamus decreased size, abnormal WT + MO1-cdx1b Fig. 2 with image from Cheng et al., 2008
intestinal bulb cell population proliferation increased process quality, abnormal WT + MO1-cdx1b Fig. 9 with image from Chen et al., 2009
intestinal bulb enterocyte slc15a1b expression decreased amount, abnormal WT + MO1-cdx1b Fig. 5 with image from Chen et al., 2009
intestinal bulb enterocyte decreased height, abnormal WT + MO1-cdx1b Fig. 6 with image from Chen et al., 2009
intestinal bulb microvillus decreased amount, abnormal WT + MO1-cdx1b Fig. 6 with image from Chen et al., 2009
intestinal bulb microvillus decreased length, abnormal WT + MO1-cdx1b Fig. 6 with image from Chen et al., 2009
intestinal epithelial cell cuboid, abnormal WT + MO1-cdx1b Fig. 2 with image from Chen et al., 2009
intestinal epithelial cell nucleus pleomorphic, abnormal WT + MO1-cdx1b Fig. 2 with image from Chen et al., 2009
intestine decreased size, abnormal WT + MO1-cdx1b Fig. 3 with image from Cheng et al., 2008
intestine goblet cell decreased amount, abnormal WT + MO1-cdx1b Fig. 3 with image from Chen et al., 2009
intestine goblet cell agr2 expression decreased amount, abnormal WT + MO1-cdx1b Fig. 3 with image from Chen et al., 2009
liver decreased size, abnormal WT + MO1-cdx1b Fig. 3 with image,  Fig. S5 with image from Cheng et al., 2008
mesodermal cell decreased amount, abnormal WT + MO1-cdx1b Fig. 4 with image from Cheng et al., 2008
mid intestine cell population proliferation increased process quality, abnormal WT + MO1-cdx1b Fig. 9 with image from Chen et al., 2009
mid intestine enterocyte decreased height, abnormal WT + MO1-cdx1b Fig. 6 with image from Chen et al., 2009
mid intestine goblet cell immature, abnormal WT + MO1-cdx1b Fig. 6 with image from Chen et al., 2009
mid intestine microvillus decreased amount, abnormal WT + MO1-cdx1b Fig. 6 with image from Chen et al., 2009
mid intestine microvillus decreased length, abnormal WT + MO1-cdx1b Fig. 6 with image from Chen et al., 2009
pericardium edematous, abnormal WT + MO1-cdx1b Fig. 2 with image from Chen et al., 2009
Fig. 2 with image from Cheng et al., 2008
trunk curved ventral, abnormal WT + MO1-cdx1b Fig. 2 with image from Cheng et al., 2008
whole organism curved ventral, abnormal WT + MO1-cdx1b Fig. 2 with image from Chen et al., 2009
whole organism slc15a1b expression decreased amount, abnormal WT + MO1-cdx1b Fig. 5 with image from Chen et al., 2009
whole organism increased curvature, abnormal WT + MO1-cdx1b Fig. 2 with image from Chen et al., 2009
zona limitans intrathalamica decreased size, abnormal WT + MO1-cdx1b Fig. 2 with image from Cheng et al., 2008
Phenotype of all Fish created by or utilizing MO1-cdx1b
Phenotype Fish Conditions Figures
diencephalon dorsal region ndr2 expression absent, abnormal AB + MO1-cdx1b control Table 1 from Wu et al., 2020
diencephalon dorsal region lft1 expression absent, abnormal AB + MO1-cdx1b control Table 1 from Wu et al., 2020
diencephalon dorsal region lft1 expression mislocalised, abnormal AB + MO1-cdx1b control Fig. 7 with image from Wu et al., 2020
diencephalon dorsal region pitx2 expression absent, abnormal AB + MO1-cdx1b control Table 1 from Wu et al., 2020
hypothalamus decreased size, abnormal WT + MO1-cdx1b standard conditions Fig. 2 with image from Cheng et al., 2008
heart shape, abnormal WT + MO1-cdx1b control Fig. 2 with image from Chen et al., 2009
mid intestine microvillus decreased amount, abnormal WT + MO1-cdx1b control Fig. 6 with image from Chen et al., 2009
intestinal epithelial cell nucleus pleomorphic, abnormal WT + MO1-cdx1b control Fig. 2 with image from Chen et al., 2009
intestinal bulb enterocyte decreased height, abnormal WT + MO1-cdx1b control Fig. 6 with image from Chen et al., 2009
mid intestine cell population proliferation increased process quality, abnormal WT + MO1-cdx1b control Fig. 9 with image from Chen et al., 2009
whole organism increased curvature, abnormal WT + MO1-cdx1b control Fig. 2 with image from Chen et al., 2009
enterocyte microvillus decreased length, abnormal WT + MO1-cdx1b control Fig. 6 with image from Chen et al., 2009
determination of left/right symmetry disrupted, abnormal WT + MO1-cdx1b standard conditions Fig. 3 with image from Cheng et al., 2008
liver decreased size, abnormal WT + MO1-cdx1b standard conditions Fig. 3 with image,  Fig. S5 with image from Cheng et al., 2008
intestinal epithelial cell cuboid, abnormal WT + MO1-cdx1b control Fig. 2 with image from Chen et al., 2009
intestinal bulb enterocyte slc15a1b expression decreased amount, abnormal WT + MO1-cdx1b control Fig. 5 with image from Chen et al., 2009
endocrine pancreas decreased size, abnormal WT + MO1-cdx1b standard conditions Fig. 3 with image from Cheng et al., 2008
enterocyte cuboid, abnormal WT + MO1-cdx1b control Fig. 6 with image from Chen et al., 2009
goblet cell secretory granule decreased amount, abnormal WT + MO1-cdx1b control Fig. 6 with image from Chen et al., 2009
intestinal bulb cell population proliferation increased process quality, abnormal WT + MO1-cdx1b control Fig. 9 with image from Chen et al., 2009
basal plate midbrain region decreased size, abnormal WT + MO1-cdx1b standard conditions Fig. 2 with image from Cheng et al., 2008
heart looping disrupted, abnormal WT + MO1-cdx1b standard conditions Fig. 2 with image from Chen et al., 2009
Fig. 2 with image from Cheng et al., 2008
pericardium edematous, abnormal WT + MO1-cdx1b standard conditions Fig. 2 with image from Chen et al., 2009
Fig. 2 with image from Cheng et al., 2008
enteroendocrine cell nkx2.2a expression decreased amount, abnormal WT + MO1-cdx1b control Fig. 4 with image from Chen et al., 2009
zona limitans intrathalamica decreased size, abnormal WT + MO1-cdx1b standard conditions Fig. 2 with image from Cheng et al., 2008
mid intestine microvillus decreased length, abnormal WT + MO1-cdx1b control Fig. 6 with image from Chen et al., 2009
mid intestine enterocyte decreased height, abnormal WT + MO1-cdx1b control Fig. 6 with image from Chen et al., 2009
exocrine pancreas decreased size, abnormal WT + MO1-cdx1b standard conditions Fig. 3 with image,  Fig. S5 with image from Cheng et al., 2008
intestine decreased size, abnormal WT + MO1-cdx1b standard conditions Fig. 3 with image from Cheng et al., 2008
digestive tract morphogenesis disrupted, abnormal WT + MO1-cdx1b standard conditions Fig. S5 with image from Cheng et al., 2008
intestine goblet cell decreased amount, abnormal WT + MO1-cdx1b control Fig. 3 with image from Chen et al., 2009
mid intestine goblet cell immature, abnormal WT + MO1-cdx1b control Fig. 6 with image from Chen et al., 2009
whole organism slc15a1b expression decreased amount, abnormal WT + MO1-cdx1b control Fig. 5 with image from Chen et al., 2009
mesodermal cell decreased amount, abnormal WT + MO1-cdx1b standard conditions Fig. 4 with image from Cheng et al., 2008
enterocyte morphology, abnormal WT + MO1-cdx1b control Fig. 6 with image from Chen et al., 2009
enteroendocrine cell decreased amount, abnormal WT + MO1-cdx1b control Fig. 4 with image from Chen et al., 2009
trunk curved ventral, abnormal WT + MO1-cdx1b standard conditions Fig. 2 with image from Cheng et al., 2008
endodermal cell decreased amount, abnormal WT + MO1-cdx1b standard conditions Fig. 4 with image from Cheng et al., 2008
intestinal bulb microvillus decreased amount, abnormal WT + MO1-cdx1b control Fig. 6 with image from Chen et al., 2009
intestine goblet cell agr2 expression decreased amount, abnormal WT + MO1-cdx1b control Fig. 3 with image from Chen et al., 2009
intestinal bulb microvillus decreased length, abnormal WT + MO1-cdx1b control Fig. 6 with image from Chen et al., 2009
whole organism curved ventral, abnormal WT + MO1-cdx1b control Fig. 2 with image from Chen et al., 2009
eye decreased distance eye, abnormal WT + MO1-cdx1b standard conditions Fig. 2 with image from Cheng et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.