| ZFIN ID: ZDB-SSLP-980528-985 |
| SSLP: | z8146 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 10 | 27.9 cM | z8146 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 10 | 95.46 cR | Z8146 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 10 | 299.0 cR | z8146 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 10 | 7.5 cM | z8146 | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z9473 | SSLP | 10 | Lieschke et al., 2001 | Lieschke et. al. (2001, Blood 98(10):3087-3096) report mapping mpx to LG10 on the T51 radiation hybrid panel using SSLPs. | |
| mpx | GENE | 10 | Lieschke et al., 2001 | Lieschke et. al. (2001, Blood 98(10):3087-3096) report mapping mpx to LG10 on the T51 radiation hybrid panel using SSLPs. |
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| IND | 146,220 | 60.0 | |
| Forward Primer | AGCGGAGATGATGACTTGGT | ||
| Reverse Primer | TCCGCCTCTAGAGAGACTGC | ||
| AB | 160,0,142 | 60.0 | |
| Forward Primer | AGCGGAGATGATGACTTGGT | ||
| Reverse Primer | TCCGCCTCTAGAGAGACTGC | ||
| EKW | 148,0,144 | 60.0 | |
| Forward Primer | AGCGGAGATGATGACTTGGT | ||
| Reverse Primer | TCCGCCTCTAGAGAGACTGC | ||
| TU | 0,154,146 | 60.0 | |
| Forward Primer | AGCGGAGATGATGACTTGGT | ||
| Reverse Primer | TCCGCCTCTAGAGAGACTGC |