Mapping Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
3	50.4 cM	z5197	Boston MGH Cross (MGH)	Fishman, Mark C.	Data
3	2211.0 cR	z5197	Goodfellow T51 (T51)	Geisler, Robert	Data
3	44.1 cM	z5197	Heat Shock (HS)	Woods, Ian G.	Data
3	54.66 cM		Gates et al (GAT)	Talbot, William S.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
z10805	SSLP	3		Eames et al., 2011	Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128  ... Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128 and b1189 to the zylt1 gene on LG3, using markers Z5197, z59609, Z10805 and Z963.
xylt1	GENE	3		Eames et al., 2011	Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128  ... Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128 and b1189 to the zylt1 gene on LG3, using markers Z5197, z59609, Z10805 and Z963.
b1189	Feature	3		Eames et al., 2011	Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128  ... Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128 and b1189 to the zylt1 gene on LG3, using markers Z5197, z59609, Z10805 and Z963.
b1128	Feature	3		Eames et al., 2011	Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128  ... Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128 and b1189 to the zylt1 gene on LG3, using markers Z5197, z59609, Z10805 and Z963.
z59609	SSLP	3		Eames et al., 2011	Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128  ... Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128 and b1189 to the zylt1 gene on LG3, using markers Z5197, z59609, Z10805 and Z963.
z963	SSLP	3		Eames et al., 2011	Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128  ... Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128 and b1189 to the zylt1 gene on LG3, using markers Z5197, z59609, Z10805 and Z963.
b1128	Feature	3	0.7 cM	Miller et al., 2007	Miller et al. report mapping b1128 to linkage group 3 between z15460 and z5197  ... Miller et al. report mapping b1128 to linkage group 3 between z15460 and z5197 by RAD marker mapping.
z15460	SSLP	3		Miller et al., 2007	Miller et al. report mapping b1128 to linkage group 3 between z15460 and z5197  ... Miller et al. report mapping b1128 to linkage group 3 between z15460 and z5197 by RAD marker mapping.

OTHER MAPPING INFORMATION

Chr 3 Eames et al., 2011 Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128 and b1189 to the  ... Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128 and b1189 to the zylt1 gene on LG3, using markers Z5197, z59609, Z10805 and Z963.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
IND	171,183
Forward Primer	CCAATCTGCAAATGTCACCAGG
Reverse Primer	TGTGCACAGCCGTTCCTACA
AB	251
Forward Primer	CCAATCTGCAAATGTCACCAGG
Reverse Primer	TGTGCACAGCCGTTCCTACA