Mapping Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
23	36.6 cM	z5141	Boston MGH Cross (MGH)	Fishman, Mark C.	Data
23	411.49 cR	Z5141	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
23	5107.0 cR	z5141	Goodfellow T51 (T51)	Geisler, Robert	Data
23	96.9 cM	z5141	Heat Shock (HS)	Woods, Ian G.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
z20492	SSLP	23		Crump et al., 2004	Crump et al.(2004 PLoS Biol. 2(9):E244) reports mapping itga5b926 to LG 23 between the markers Z5141 and Z20492.
itga5	GENE	23		Crump et al., 2004	Crump et al.(2004 PLoS Biol. 2(9):E244) reports mapping itga5b926 to LG 23 between the markers Z5141 and Z20492.
s228	Feature	23		Herzog et al., 2009	Herzog, et al. (2009. Circ. Res. 104(11): 1260-1266.) reports mapping adr  ... Herzog, et al. (2009. Circ. Res. 104(11): 1260-1266.) reports mapping adr mutants to the sars gene on LG23 between Z20725 and Z5141.
sars1	GENE	23		Herzog et al., 2009	Herzog, et al. (2009. Circ. Res. 104(11): 1260-1266.) reports mapping adr  ... Herzog, et al. (2009. Circ. Res. 104(11): 1260-1266.) reports mapping adr mutants to the sars gene on LG23 between Z20725 and Z5141.
z20725	SSLP	23		Herzog et al., 2009	Herzog, et al. (2009. Circ. Res. 104(11): 1260-1266.) reports mapping adr  ... Herzog, et al. (2009. Circ. Res. 104(11): 1260-1266.) reports mapping adr mutants to the sars gene on LG23 between Z20725 and Z5141.
s277	Feature	23		Herzog et al., 2009	Herzog, et al. (2009. Circ. Res. 104(11): 1260-1266.) reports mapping adr  ... Herzog, et al. (2009. Circ. Res. 104(11): 1260-1266.) reports mapping adr mutants to the sars gene on LG23 between Z20725 and Z5141.
itga5	GENE	23		Jülich et al., 2005	bfe was mapped via meiotic recombination to a 144 kb region containing a  ... bfe was mapped via meiotic recombination to a 144 kb region containing a predicted homolog of itga5. Single embryo mapping placed bfe between SSLPs z4421 and z5141 on LG23.
kt293	Feature	23	1.33 cM	Koshida et al., 2005
z20725	SSLP	23		Koshida et al., 2005
ptges3a	GENE	23		Pini et al., 2005
z6142	SSLP	23		Pini et al., 2005

OTHER MAPPING INFORMATION

Chr 23 Crump et al., 2004 Crump et al.(2004 PLoS Biol. 2(9):E244) reports mapping itga5b926 to LG 23  ... Crump et al.(2004 PLoS Biol. 2(9):E244) reports mapping itga5b926 to LG 23 between the markers Z5141 and Z20492.   Chr 23 Jülich et al., 2005 bfe was mapped via meiotic recombination to a 144 kb region containing a predicted homolog of  ... bfe was mapped via meiotic recombination to a 144 kb region containing a predicted homolog of itga5. Single embryo mapping placed bfe between SSLPs z4421 and z5141 on LG23.   Chr 23 Pini et al., 2005   Chr 23 Herzog et al., 2009 Herzog, et al. (2009. Circ. Res. 104(11): 1260-1266.) reports mapping adr mutants to the sars gene  ... Herzog, et al. (2009. Circ. Res. 104(11): 1260-1266.) reports mapping adr mutants to the sars gene on LG23 between Z20725 and Z5141.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
IND	NA
Forward Primer	GGACAGTCTTGCCTGACAGCTG
Reverse Primer	CAAGTGCTGCCATCAGCATACA
AB	NA
Forward Primer	GGACAGTCTTGCCTGACAGCTG
Reverse Primer	CAAGTGCTGCCATCAGCATACA