Mapping Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
6	59.6 cM	z4950	Boston MGH Cross (MGH)	Fishman, Mark C.	Data
6	494.76 cR	Z4950	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
6	5869.0 cR	z4950	Goodfellow T51 (T51)	Geisler, Robert	Data
6	127.7 cM	z4950	Heat Shock (HS)	Woods, Ian G.	Data
6	95.26 cM		Gates et al (GAT)	Talbot, William S.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
ngfb	GENE	6	0.0 cR	Dethleffsen et al., 2003	Dethleffsen K et al. (Mol Cell Neurosci 24, 380-394) mapped the ngfb gene to  ... Dethleffsen K et al. (Mol Cell Neurosci 24, 380-394) mapped the ngfb gene to LG6, 0.00 cR from z4950.
fb79e06	EST	6		Hong et al., 2008	Hong, et al. (2008. PLoS One 3(4):e2029) reports mapping mych to LG6 between  ... Hong, et al. (2008. PLoS One 3(4):e2029) reports mapping mych to LG6 between fb72h03/fd59e02/z1050/z4950 and fb79e06 (mislabeled as fb79e08 in Fig. 1) on the LN54 mapping panel.
z1050	SSLP	6		Hong et al., 2008	Hong, et al. (2008. PLoS One 3(4):e2029) reports mapping mych to LG6 between  ... Hong, et al. (2008. PLoS One 3(4):e2029) reports mapping mych to LG6 between fb72h03/fd59e02/z1050/z4950 and fb79e06 (mislabeled as fb79e08 in Fig. 1) on the LN54 mapping panel.
fb72h03	EST	6		Hong et al., 2008	Hong, et al. (2008. PLoS One 3(4):e2029) reports mapping mych to LG6 between  ... Hong, et al. (2008. PLoS One 3(4):e2029) reports mapping mych to LG6 between fb72h03/fd59e02/z1050/z4950 and fb79e06 (mislabeled as fb79e08 in Fig. 1) on the LN54 mapping panel.
mych	GENE	6	7.25 cR	Hong et al., 2008	Hong, et al. (2008. PLoS One 3(4):e2029) reports mapping mych to LG6 between  ... Hong, et al. (2008. PLoS One 3(4):e2029) reports mapping mych to LG6 between fb72h03/fd59e02/z1050/z4950 and fb79e06 (mislabeled as fb79e08 in Fig. 1) on the LN54 mapping panel.
fd59e02	EST	6		Hong et al., 2008	Hong, et al. (2008. PLoS One 3(4):e2029) reports mapping mych to LG6 between  ... Hong, et al. (2008. PLoS One 3(4):e2029) reports mapping mych to LG6 between fb72h03/fd59e02/z1050/z4950 and fb79e06 (mislabeled as fb79e08 in Fig. 1) on the LN54 mapping panel.
gli1	GENE	6		Karlstrom et al., 2003	Karlstrom et al. (2003) used centromere linkage analysis to map the detour (dtr) locus to the gli1 gene on Linkage Group 6.
z3581	SSLP	6		Karlstrom et al., 2003	Karlstrom et al. (2003) used centromere linkage analysis to map the detour (dtr) locus to the gli1 gene on Linkage Group 6.
z4910	SSLP	6		Karlstrom et al., 2003	Karlstrom et al. (2003) used centromere linkage analysis to map the detour (dtr) locus to the gli1 gene on Linkage Group 6.
ts269	Feature	6		Karlstrom et al., 2003	Karlstrom et al. (2003) used centromere linkage analysis to map the detour (dtr) locus to the gli1 gene on Linkage Group 6.

OTHER MAPPING INFORMATION

Chr 6 Karlstrom et al., 2003 Karlstrom et al. (2003) used centromere linkage analysis to map the detour (dtr) locus to  ... Karlstrom et al. (2003) used centromere linkage analysis to map the detour (dtr) locus to the gli1 gene on Linkage Group 6.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
IND	190,208
Forward Primer	AAACGGATTCACAGACGAGCG
Reverse Primer	TTCATGAATGAGGCCCACTTTG
AB	178,186
Forward Primer	AAACGGATTCACAGACGAGCG
Reverse Primer	TTCATGAATGAGGCCCACTTTG