| ZFIN ID: ZDB-SSLP-980528-1920 |
| SSLP: | z21452 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 15 | 49.3 cM | z21452 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 15 | 167.51 cR | Z21452 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z470 | SSLP | 15 | Guo et al., 2000 | Guo, et al. (2000. Nature 408:366-369.) report mapping supt5h to LG15 between z470 and z21452. Two AFLP markers were used to identify large clones spanning supt5h and a chromosome walk localized the gene. | |
| supt5h | GENE | 15 | Guo et al., 2000 | Guo, et al. (2000. Nature 408:366-369.) report mapping supt5h to LG15 between z470 and z21452. Two AFLP markers were used to identify large clones spanning supt5h and a chromosome walk localized the gene. |
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| AB | 0,148 | 60.0 | |
| Forward Primer | GCCAAGAGATTGCACATGAC | ||
| Reverse Primer | TGATGCAGACAGGATTCTGC | ||
| IND | 166,0,156 | 60.0 | |
| Forward Primer | GCCAAGAGATTGCACATGAC | ||
| Reverse Primer | TGATGCAGACAGGATTCTGC | ||
| EKW | 0,148 | 60.0 | |
| Forward Primer | GCCAAGAGATTGCACATGAC | ||
| Reverse Primer | TGATGCAGACAGGATTCTGC | ||
| TU | 200,0,146 | 60.0 | |
| Forward Primer | GCCAAGAGATTGCACATGAC | ||
| Reverse Primer | TGATGCAGACAGGATTCTGC |