| ZFIN ID: ZDB-SSLP-980528-1697 |
| SSLP: | z13695 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 24 | 37.0 cM | z13695 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 24 | 235.25 cR | Z13695 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 24 | 1293.0 cR | z13695 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z23011 | SSLP | 24 | Holzschuh et al., 2003 | Holzschuh et al. (2003, Development 130: 5741-5754) report mapping mobm819 to LG24 between SSLP markers z23011 and z13695 using bulk segregant analysis. mobm819 linked to tfap2a through RFLP analysis. | |
| tfap2a | GENE | 24 | Holzschuh et al., 2003 | Holzschuh et al. (2003, Development 130: 5741-5754) report mapping mobm819 to LG24 between SSLP markers z23011 and z13695 using bulk segregant analysis. mobm819 linked to tfap2a through RFLP analysis. | |
| m819 | Feature | 24 | 2.75 cM | Holzschuh et al., 2003 | Holzschuh et al. (2003, Development 130: 5741-5754) report mapping mobm819 to LG24 between SSLP markers z23011 and z13695 using bulk segregant analysis. mobm819 linked to tfap2a through RFLP analysis. |
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| AB | 0,133 | 60.0 | |
| Forward Primer | TGTCGTAGGACATGGGGATT | ||
| Reverse Primer | TCGCTGCTTCGTTCTCACTA | ||
| IND | 127,0,119 | 60.0 | |
| Forward Primer | TGTCGTAGGACATGGGGATT | ||
| Reverse Primer | TCGCTGCTTCGTTCTCACTA | ||
| TU | 119,0,133 | 60.0 | |
| Forward Primer | TGTCGTAGGACATGGGGATT | ||
| Reverse Primer | TCGCTGCTTCGTTCTCACTA | ||
| EKW | 0,133 | 60.0 | |
| Forward Primer | TGTCGTAGGACATGGGGATT | ||
| Reverse Primer | TCGCTGCTTCGTTCTCACTA |