| ZFIN ID: ZDB-SSLP-980528-1380 |
| SSLP: | z10352 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 12 | 32.0 cM | z10352 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 12 | 100.1 cR | Z10352 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 12 | 659.0 cR | z10352 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 12 | 33.3 cM | z10352 | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z22103 | SSLP | 12 | Hailey et al., 2012 | Hailey et al.(2012, PLoS Genet. 8(10):e1002971) mapped persw39 to chr. 12. | |
| w39 | Feature | 12 | 33.3 cM | Hailey et al., 2012 | Hailey et al.(2012, PLoS Genet. 8(10):e1002971) mapped persw39 to chr. 12. |
| z23536 | SSLP | 12 | Hailey et al., 2012 | Hailey et al.(2012, PLoS Genet. 8(10):e1002971) mapped persw39 to chr. 12. |
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| AB | 180,170 | 60.0 | |
| Forward Primer | TGGCTGACAGGAAACACAGA | ||
| Reverse Primer | TACCATCGCTGACAATCGAG | ||
| IND | 180,0,168 | 60.0 | |
| Forward Primer | TGGCTGACAGGAAACACAGA | ||
| Reverse Primer | TACCATCGCTGACAATCGAG | ||
| EKW | 180,170,0,168 | 60.0 | |
| Forward Primer | TGGCTGACAGGAAACACAGA | ||
| Reverse Primer | TACCATCGCTGACAATCGAG | ||
| TU | 0,168 | 60.0 | |
| Forward Primer | TGGCTGACAGGAAACACAGA | ||
| Reverse Primer | TACCATCGCTGACAATCGAG |