| ZFIN ID: ZDB-SSLP-980528-1184 |
| SSLP: | z9321 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 24 | 42.9 cM | z9321 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 24 | 292.36 cR | Z9321 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 24 | 1869.0 cR | z9321 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z7823 | SSLP | 24 | Kozlowski et al., 2005 | Kozlowski et al. (2005, Dev. Biol. 277(1):27-41) used meiotic mapping to localize dogtm90b to LG24 1.6cM from z7823 and .1 cM from z9321. They also found that the corresponding EST, fc13c10, was located between the same markers. | |
| tm90b | Feature | 24 | 0.1 cM | Kozlowski et al., 2005 | Kozlowski et al. (2005, Dev. Biol. 277(1):27-41) used meiotic mapping to localize dogtm90b to LG24 1.6cM from z7823 and .1 cM from z9321. They also found that the corresponding EST, fc13c10, was located between the same markers. |
| fc13c10 | EST | 24 | 45.1 cR | Kozlowski et al., 2005 | Kozlowski et al. (2005, Dev. Biol. 277(1):27-41) used meiotic mapping to localize dogtm90b to LG24 1.6cM from z7823 and .1 cM from z9321. They also found that the corresponding EST, fc13c10, was located between the same markers. |
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| AB | 208 | 60.0 | |
| Forward Primer | TGTGGGAGAAAGAAGAGCGT | ||
| Reverse Primer | TCAAATCTTGCACGCTGATC | ||
| IND | 0,224 | 60.0 | |
| Forward Primer | TGTGGGAGAAAGAAGAGCGT | ||
| Reverse Primer | TCAAATCTTGCACGCTGATC | ||
| TU | 206,204 | 60.0 | |
| Forward Primer | TGTGGGAGAAAGAAGAGCGT | ||
| Reverse Primer | TCAAATCTTGCACGCTGATC | ||
| EKW | 232,204 | 60.0 | |
| Forward Primer | TGTGGGAGAAAGAAGAGCGT | ||
| Reverse Primer | TCAAATCTTGCACGCTGATC |