Mapping Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
14	53.6 cM	z8801	Boston MGH Cross (MGH)	Fishman, Mark C.	Data
14	601.3 cR	Z8801	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
14	3867.0 cR	z8801	Goodfellow T51 (T51)	Geisler, Robert	Data
14	84.5 cM	z8801	Heat Shock (HS)	Woods, Ian G.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
z21080	SSLP	14		Hirata et al., 2005	glrb2 (glrbb) gene was physically mapped on the LN54 panel to chromosome 14  ... glrb2 (glrbb) gene was physically mapped on the LN54 panel to chromosome 14 close to Z21080 and Z8801, two polymorphic markers meiotically linked to the bandoneon (beo) locus.
mi106a	Feature	14		Hirata et al., 2005	glrb2 (glrbb) gene was physically mapped on the LN54 panel to chromosome 14  ... glrb2 (glrbb) gene was physically mapped on the LN54 panel to chromosome 14 close to Z21080 and Z8801, two polymorphic markers meiotically linked to the bandoneon (beo) locus.
tp221	Feature	14		Hirata et al., 2005	glrb2 (glrbb) gene was physically mapped on the LN54 panel to chromosome 14  ... glrb2 (glrbb) gene was physically mapped on the LN54 panel to chromosome 14 close to Z21080 and Z8801, two polymorphic markers meiotically linked to the bandoneon (beo) locus.
tw38f	Feature	14		Hirata et al., 2005	glrb2 (glrbb) gene was physically mapped on the LN54 panel to chromosome 14  ... glrb2 (glrbb) gene was physically mapped on the LN54 panel to chromosome 14 close to Z21080 and Z8801, two polymorphic markers meiotically linked to the bandoneon (beo) locus.
glrbb	GENE	14		Hirata et al., 2005	glrb2 (glrbb) gene was physically mapped on the LN54 panel to chromosome 14  ... glrb2 (glrbb) gene was physically mapped on the LN54 panel to chromosome 14 close to Z21080 and Z8801, two polymorphic markers meiotically linked to the bandoneon (beo) locus.
ty40	Feature	unknown	1.6 cM	Mullins, 1999
z20663	SSLP	14	0.3 cM	Topczewski et al., 2001	Topczewski, et al. (2001. Dev Cell 1:251-264.) report using a panel of 1150 meioses to map kny to LG14 near z3091, z8801, and z20663. A chromosome walk using PACs and YACs physically maps these loci.
m119	Feature	14		Topczewski et al., 2001	Topczewski, et al. (2001. Dev Cell 1:251-264.) report using a panel of 48 meioses to map knym119 close to z3091, z8801, and z20663.
z3091	SSLP	14	0.4 cM	Topczewski et al., 2001	Topczewski, et al. (2001. Dev Cell 1:251-264.) report using a panel of 1150 meioses to map kny to LG14 near z3091, z8801, and z20663. A chromosome walk using PACs and YACs physically maps these loci.
z20663	SSLP	14		Topczewski et al., 2001	Topczewski, et al. (2001. Dev Cell 1:251-264.) report using a panel of 48 meioses to map knym119 close to z3091, z8801, and z20663.
z3091	SSLP	14		Topczewski et al., 2001	Topczewski, et al. (2001. Dev Cell 1:251-264.) report using a panel of 48 meioses to map knym119 close to z3091, z8801, and z20663.
gpc4	GENE	14	0.1 cM	Topczewski et al., 2001	Topczewski, et al. (2001. Dev Cell 1:251-264.) report using a panel of 1150 meioses to map kny to LG14 near z3091, z8801, and z20663. A chromosome walk using PACs and YACs physically maps these loci.
m119	Feature	14	0.1 cM	Topczewski et al., 2001

OTHER MAPPING INFORMATION

Chr 14 Topczewski et al., 2001 Topczewski, et al. (2001. Dev Cell 1:251-264.) report using a panel of 48 meioses to map  ... Topczewski, et al. (2001. Dev Cell 1:251-264.) report using a panel of 48 meioses to map knym119 close to z3091, z8801, and z20663.   Chr 14 Hirata et al., 2005 glrb2 (glrbb) gene was physically mapped on the LN54 panel to chromosome 14 close to Z21080 and  ... glrb2 (glrbb) gene was physically mapped on the LN54 panel to chromosome 14 close to Z21080 and Z8801, two polymorphic markers meiotically linked to the bandoneon (beo) locus.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
AB	0,233		60.0
Forward Primer	TCAATACACCCAGTGCCAAA
Reverse Primer	GAGGGCTCTGAATTCCTTCC
IND	0,241,225		60.0
Forward Primer	TCAATACACCCAGTGCCAAA
Reverse Primer	GAGGGCTCTGAATTCCTTCC
TU	0,235,229		60.0
Forward Primer	TCAATACACCCAGTGCCAAA
Reverse Primer	GAGGGCTCTGAATTCCTTCC
EKW	229,0,233		60.0
Forward Primer	TCAATACACCCAGTGCCAAA
Reverse Primer	GAGGGCTCTGAATTCCTTCC