| ZFIN ID: ZDB-SSLP-980528-1059 |
| SSLP: | z8554 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 20 | 107.2 cM | z8554 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 20 | 731.87 cR | Z8554 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 20 | 4629.0 cR | z8554 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 20 | 134.8 cM | z8554 | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| to14mx | Feature | 20 | 0.6 cM | Clément et al., 2008 | Clément et al. (2008. PLoS Genet. 4: e1000136) report mapping the pic locus to ... |
| z1534 | SSLP | 20 | Clément et al., 2008 | Clément et al. (2008. PLoS Genet. 4: e1000136) report mapping the pic locus to ... |
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| AB | 142,138 | 60.0 | |
| Forward Primer | CGGTAAATCAGTCCCAGCAT | ||
| Reverse Primer | ACCTCTGCAGGACTGAGGAA | ||
| IND | 152,148 | 60.0 | |
| Forward Primer | CGGTAAATCAGTCCCAGCAT | ||
| Reverse Primer | ACCTCTGCAGGACTGAGGAA | ||
| EKW | 148,142 | 60.0 | |
| Forward Primer | CGGTAAATCAGTCCCAGCAT | ||
| Reverse Primer | ACCTCTGCAGGACTGAGGAA | ||
| TU | 142,156,148 | 60.0 | |
| Forward Primer | CGGTAAATCAGTCCCAGCAT | ||
| Reverse Primer | ACCTCTGCAGGACTGAGGAA |