| ZFIN ID: ZDB-SSLP-980528-1042 |
| SSLP: | z8460 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 12 | 52.7 cM | z8460 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 12 | 238.86 cR | Z8460 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 12 | 4191.0 cR | z8460 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 12 | 77.0 cM | z8460 | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z10122 | SSLP | 12 | Lyons et al., 2005 | Lyons et al.(2005, Curr. Biol. 15(6):513-524) mapped erbb2 to LG12 using bulk segregant analysis. | |
| z1473 | SSLP | 12 | Lyons et al., 2005 | Lyons et al.(2005, Curr. Biol. 15(6):513-524) mapped erbb2 to LG12 using bulk segregant analysis. | |
| st61 | Feature | 12 | Lyons et al., 2005 | Lyons et al.(2005, Curr. Biol. 15(6):513-524) mapped erbb2 to LG12 using bulk segregant analysis. | |
| st50 | Feature | 12 | 25.0 cM | Lyons et al., 2005 | Lyons et al.(2005, Curr. Biol. 15(6):513-524) mapped erbb2 to LG12 using bulk segregant analysis. |
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| AB | 0,222 | 60.0 | |
| Forward Primer | TGGTGGTGTGGAAAATTTCA | ||
| Reverse Primer | ATGACCAACCGTGAGGAAAG | ||
| IND | 0,246,178 | 60.0 | |
| Forward Primer | TGGTGGTGTGGAAAATTTCA | ||
| Reverse Primer | ATGACCAACCGTGAGGAAAG | ||
| TU | 0,188 | 60.0 | |
| Forward Primer | TGGTGGTGTGGAAAATTTCA | ||
| Reverse Primer | ATGACCAACCGTGAGGAAAG | ||
| EKW | 0,222 | 60.0 | |
| Forward Primer | TGGTGGTGTGGAAAATTTCA | ||
| Reverse Primer | ATGACCAACCGTGAGGAAAG |