ZFIN ID: ZDB-GENE-980526-442

ZFIN ID: ZDB-GENE-980526-442

Mapping Details

Gene Name:	growth differentiation factor 6b
Symbol:	gdf6b

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	19	25,407,845 - 25,413,508	GRCz12tu
NCBI Map Viewer	19	25,407,845 - 25,413,508	GRCz12tu
Ensembl	19	22,999,181 - 23,002,883	GRCz11
NCBI Map Viewer	19	22,999,269 - 23,002,708	GRCz11
UCSC	19	-	GRCz11
Vega	19	23,414,858 - 23,418,560	GRCv10

Mapped Clones containing gdf6b
DKEY-158E13	Chr: 19 Details
CH211-244A23	Chr: 19 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
sa23521	19	25,410,424	GRCz12tu	DIRECT		Sealy et al., 2025
	19	23,001,848	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	19	23,417,525	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	19	23,488,110	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa36836	19	25,410,404	GRCz12tu	DIRECT		Sealy et al., 2025
	19	23,001,828	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	19	23,417,505	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	19	23,488,090	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa43280	19	25,410,394	GRCz12tu	DIRECT		Sealy et al., 2025
	19	23,001,818	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	19	23,417,495	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	19	23,488,080	Zv9	DIRECT		Busch-Nentwich et al., 2013
zf3339	19	22,999,561 - 22,999,568	GRCz11	DIRECT		Gramann et al., 2019
sa23521	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	19		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
sa36836	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	19		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
sa43280	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	19		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
zf3339	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	19		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	19		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
19	94.3 cM	dynamo	Mother of Pearl (MOP)	Postlethwait, John H.	Data
19	66.6 cM	gdf6b	Heat Shock (HS)	Woods, Ian G.	Data
19	40.42 cM	dynamo	Gates et al (GAT)	Talbot, William S.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS
Marker	Type	Chr	Distance	Publication / Person	Comments
mc5ra	GENE	19	0.0 cM	Ringholm et al., 2002	Ringholm et al. (2002, J Neurochem 82(1):6-18) report mapping mc5ra to LG 19, 12.3 cM from hoxa11a, indistinguishably close to gdf6b, using the Heat Shock mapping panel.
hoxa11a	GENE	19		Ringholm et al., 2002	Ringholm et al. (2002, J Neurochem 82(1):6-18) report mapping mc5ra to LG 19, 12.3 cM from hoxa11a, indistinguishably close to gdf6b, using the Heat Shock mapping panel.

Markers Encoded by gdf6b
fc13c07 Chr: 19 Details

Primer Sets:
Strain	Bandsize	Annealing Temperature [C]
SJD	204	36.0
Forward Primer	TGTTTTTATCCAAGCAGTTCTCAC
Reverse Primer	CATTCTTGCCGTATTTTGCTCTCC