ZFIN ID: ZDB-GENE-980526-280

Mapping Details

Gene Name:	distal-less homeobox 3b
Symbol:	dlx3b

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	12	6,252,089 - 6,255,586	GRCz12tu
NCBI Map Viewer	12	6,252,089 - 6,255,586	GRCz12tu
Ensembl	12	5,708,400 - 5,711,920	GRCz11
NCBI Map Viewer	12	5,708,423 - 5,711,920	GRCz11
UCSC	12	-	GRCz11
Vega	12	5,673,443 - 5,676,963	GRCv10

Mapped Clones containing dlx3b
CH73-209K3	Chr: 12 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
sa94	12	6,252,231	GRCz12tu	DIRECT		Sealy et al., 2025
	12	5,708,565	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	12	5,673,608	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	12	6,077,717	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa22023	12	6,254,869	GRCz12tu	DIRECT		Sealy et al., 2025
	12	5,711,203	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	12	5,676,246	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	12	6,075,079	Zv9	DIRECT		Busch-Nentwich et al., 2013
zf3269	12	5,711,036 - 5,711,039	GRCz11	DIRECT		Pang et al., 2020
sa94	12		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	12		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	12		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
sa22023	12		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	12		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	12		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
zf3269	12		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	12		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	12		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
12	33.0 cM	dlx3	Mother of Pearl (MOP)	Postlethwait, John H.	Data
12	512.0 cR	dlx3	Goodfellow T51 (T51)	Geisler, Robert	Data
12	18.7 cM	dlx3	Heat Shock (HS)	Woods, Ian G.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Markers Encoded by dlx3b
fb83f11 Chr: 12 Details

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	639	HinFI	36.0
Forward Primer	AATCACTGGTACCAGCAGGG
Reverse Primer	AATGGTTCGAGCACCACC