ZFIN ID: ZDB-GENE-980526-125

Mapping Details

Gene Name: hairy-related 1
Symbol: her1
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 5 74,813,821 - 74,820,527 GRCz12tu
NCBI Map Viewer 5 74,813,821 - 74,820,527 GRCz12tu
Ensembl 5 68,788,658 - 68,795,063 GRCz11
NCBI Map Viewer 5 68,788,658 - 68,795,049 GRCz11
UCSC 5 - GRCz11
Vega 5 68,017,991 - 68,024,396 GRCv10
Mapped Clones containing her1
CH211-283H6 Chr: 5 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
ci301 5 68,794,592 - 68,794,593 GRCz11 DIRECT Zinani et al., 2020
ci302 5 68,794,592 - 68,794,593 GRCz11 DIRECT Zinani et al., 2020
hu2124 5 68,794,546 GRCz11 DIRECT Choorapoikayil et al., 2012
kt1060 5 68,794,585 - 68,794,609 GRCz11 DIRECT Yabe et al., 2023
sa40604 5 74,820,002 GRCz12tu DIRECT Sealy et al., 2025
5 68,794,552 GRCz11 DIRECT Busch-Nentwich et al., 2013
5 68,023,885 GRCz10 DIRECT Busch-Nentwich et al., 2013
5 71,699,267 Zv9 DIRECT Busch-Nentwich et al., 2013
zf2173 5 68,794,631 - 68,794,632 GRCz11 DIRECT LLeras Forero et al., 2018
ci301 5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
ci302 5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
hu2124 5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
kt1060 5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa40604 5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
zf2173 5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
5 250.1 cM her1 Mother of Pearl (MOP) Postlethwait, John H. Data
5 6345.0 cR her1 Goodfellow T51 (T51) Geisler, Robert Data
5 124.3 cM her1 Heat Shock (HS) Woods, Ian G. Data
5 125.83 cM her1 Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 638 Hha I;Msp I 36.0
Forward Primer CAATCCTCTCAACCACGGAC
Reverse Primer ACAGCAAAGACCCCAGAACA
Genomic Feature kt1060 is an allele of her1
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.