ZFIN ID: ZDB-GENE-980526-320

Mapping Details

Gene Name: early growth response 1
Symbol: egr1
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 14 25,651,454 - 25,653,695 GRCz12tu
NCBI Map Viewer 14 25,651,454 - 25,653,695 GRCz12tu
Ensembl 14 21,332,522 - 21,336,385 GRCz11
NCBI Map Viewer 14 21,333,720 - 21,335,961 GRCz11
UCSC 14 - GRCz11
Vega 14 21,035,277 - 21,039,140 GRCv10
Mapped Clones containing egr1
CH211-119C17 Chr: 14 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
sa64 14 25,652,577 GRCz12tu DIRECT Sealy et al., 2025
14 21,334,843 GRCz11 DIRECT Busch-Nentwich et al., 2013
14 21,037,598 GRCz10 DIRECT Busch-Nentwich et al., 2013
14 22,336,110 Zv9 DIRECT Busch-Nentwich et al., 2013
sa66 14 25,652,577 GRCz12tu DIRECT Sealy et al., 2025
14 21,334,843 GRCz11 DIRECT Busch-Nentwich et al., 2013
14 21,037,598 GRCz10 DIRECT Busch-Nentwich et al., 2013
14 22,336,110 Zv9 DIRECT Busch-Nentwich et al., 2013
sa469 14 25,652,158 GRCz12tu DIRECT Sealy et al., 2025
14 21,334,424 GRCz11 DIRECT Busch-Nentwich et al., 2013
14 21,037,179 GRCz10 DIRECT Busch-Nentwich et al., 2013
14 22,335,691 Zv9 DIRECT Busch-Nentwich et al., 2013
sa42385 14 25,652,275 GRCz12tu DIRECT Sealy et al., 2025
14 21,334,541 GRCz11 DIRECT Busch-Nentwich et al., 2013
14 21,037,296 GRCz10 DIRECT Busch-Nentwich et al., 2013
14 22,335,808 Zv9 DIRECT Busch-Nentwich et al., 2013
a264 14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
ihb423 14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
ihb424 14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa64 14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa66 14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa469 14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa42385 14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
stl667 14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
14 80.2 cM egr1 Mother of Pearl (MOP) Postlethwait, John H. Data
14 2553.0 cR egr1 Goodfellow T51 (T51) Geisler, Robert Data
14 66.3 cM egr1 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by egr1
fj64b05 Chr: 14 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 820 DdeI 36.0
Forward Primer GGGAGCAGTTTGATCACCTT
Reverse Primer GTGAAACGGCCTGTGTAAGA
Genomic Feature stl667 is an allele of egr1