ZFIN ID: ZDB-GENE-980526-125

Mapping Details

Gene Name: hairy-related 1
Symbol: her1
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 5 74,813,821 - 74,820,527 GRCz12tu
NCBI Map Viewer 5 74,813,821 - 74,820,527 GRCz12tu
Ensembl 5 68,788,658 - 68,795,063 GRCz11
NCBI Map Viewer 5 68,788,658 - 68,795,049 GRCz11
UCSC 5 - GRCz11
Vega 5 68,017,991 - 68,024,396 GRCv10
Mapped Clones containing her1
CH211-283H6 Chr: 5 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
ci301 5 68,794,592 - 68,794,593 GRCz11 DIRECT Zinani et al., 2020
ci302 5 68,794,592 - 68,794,593 GRCz11 DIRECT Zinani et al., 2020
hu2124 5 68,794,546 GRCz11 DIRECT Choorapoikayil et al., 2012
kt1060 5 68,794,585 - 68,794,609 GRCz11 DIRECT Yabe et al., 2023
sa40604 5 74,820,002 GRCz12tu DIRECT Sealy et al., 2025
5 68,794,552 GRCz11 DIRECT Busch-Nentwich et al., 2013
5 68,023,885 GRCz10 DIRECT Busch-Nentwich et al., 2013
5 71,699,267 Zv9 DIRECT Busch-Nentwich et al., 2013
zf2173 5 68,794,631 - 68,794,632 GRCz11 DIRECT LLeras Forero et al., 2018
ci301 5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
ci302 5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
hu2124 5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
kt1060 5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa40604 5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
zf2173 5 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
5 250.1 cM her1 Mother of Pearl (MOP) Postlethwait, John H. Data
5 6345.0 cR her1 Goodfellow T51 (T51) Geisler, Robert Data
5 124.3 cM her1 Heat Shock (HS) Woods, Ian G. Data
5 125.83 cM her1 Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 638 Hha I;Msp I 36.0
Forward Primer CAATCCTCTCAACCACGGAC
Reverse Primer ACAGCAAAGACCCCAGAACA
Genomic Feature zf2173 is an allele of her1