| ZFIN ID: ZDB-GENE-980526-102 |
| Gene Name: | SRY-box transcription factor 19a |
|---|---|
| Symbol: | sox19a |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing sox19a | |
|---|---|
| CH211-137I24 | Chr: 5 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| sa6054 | 5 | 24,857,901 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 5 | 24,200,827 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 5 | 23,697,027 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 5 | 25,869,762 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| sa7562 | 5 | 24,858,233 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 5 | 24,201,159 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 5 | 23,697,359 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 5 | 25,870,094 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| sa6054 | 5 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | ||
| 5 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 5 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| sa7562 | 5 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 5 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 5 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 5 | 73.9 cM | sox19 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 5 | 1994.0 cR | sox19 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Markers Encoded by sox19a | |||
|---|---|---|---|
| fc66c01 Chr: 5 Details | |||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 815 | MseI | 36.0 |
| Forward Primer | CGCCTCTTACACACATCTGA | ||
| Reverse Primer | TGACTCCCCTTTTTACACAACT |
| Genomic Feature sa7562 is an allele of sox19a |