ZFIN ID: ZDB-GENE-980526-29

Mapping Details

Gene Name: deltaA
Symbol: dla
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 1 57,493,665 - 57,506,500 GRCz12tu
NCBI Map Viewer 1 57,493,665 - 57,506,500 GRCz12tu
Ensembl 1 54,013,457 - 54,026,180 GRCz11
NCBI Map Viewer 1 54,013,455 - 54,026,180 GRCz11
UCSC 1 - GRCz11
Vega 1 53,353,714 - 53,366,437 GRCv10
Mapped Clones containing dla
CH211-133L11 Chr: 1 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
dx2 1 54,018,777 GRCz11 DIRECT Appel et al., 1999
hi781Tg 1 54,014,034 - 54,014,035 GRCz11 DIRECT ZFIN Curated Data
hi840Tg 1 54,014,153 - 54,014,154 GRCz11 DIRECT ZFIN Curated Data
hi3499Tg 1 54,013,553 - 54,013,554 GRCz11 DIRECT ZFIN Curated Data
ion29h 1 54,014,249 - 54,014,252 GRCz11 DIRECT Jin et al., 2022
sa19611 1 57,495,000 GRCz12tu DIRECT Sealy et al., 2025
1 54,014,790 GRCz11 DIRECT Busch-Nentwich et al., 2013
1 53,355,047 GRCz10 DIRECT Busch-Nentwich et al., 2013
1 54,581,544 Zv9 DIRECT Busch-Nentwich et al., 2013
dx2 1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
1 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
hi781Tg 1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
1 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
hi840Tg 1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
1 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
hi3499Tg 1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
1 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
ion29h 1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
1 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
nkhspGFFDMC72AEt 1 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa19611 1 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
zko1078a 1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
1 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
zko1078b 1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
1 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
1 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
1 167.3 cM deltaa Mother of Pearl (MOP) Postlethwait, John H. Data
1 6594.0 cR dla Goodfellow T51 (T51) Geisler, Robert Data
1 92.9 cM dla Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by dla
fa04c10 Chr: 1 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 452 36.0
Forward Primer GAGCGGCGGGAGAAGGAC
Reverse Primer TGGCAGAGCAGCATGTAGAGGA
Genomic Feature nkhspGFFDMC72AEt is an allele of dla