| ZFIN ID: ZDB-GENE-980526-290 |
| Gene Name: | homeobox B1b |
|---|---|
| Symbol: | hoxb1b |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing hoxb1b | |
|---|---|
| BUSM1-227H09 | Chr: 12 Details |
| DKEY-11C5 | Chr: 12 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | Citations |
|---|---|---|---|---|---|
| b1219 | 12 | 27,141,787 | GRCz11 | DIRECT | Miller et al., 2013 |
| e2214 | 12 | 28,955,049 - 28,955,050 | GRCz12tu | DIRECT | Moriyama et al., 2025 |
| um195 | 12 | 27,141,734 - 27,141,741 | GRCz11 | DIRECT | Weicksel et al., 2014 |
| um196 | 12 | 27,141,736 - 27,141,741 | GRCz11 | DIRECT | Weicksel et al., 2014 |
| um197 | 12 | 27,141,724 - 27,141,740 | GRCz11 | DIRECT | Weicksel et al., 2014 |
| b1219 | 12 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| fh095 | 12 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| fh286 | 12 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| hoxb1b_unrecovered | 12 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| tud17Gt | 12 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| ua1006 | 12 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| um195 | 12 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| um196 | 12 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| um197 | 12 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 12 | 226.68 cR | hoxa1 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 12 | 3414.0 cR | hoxb1b | Goodfellow T51 (T51) | Geisler, Robert | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| hoxb8b | GENE | 12 | Amores et al., 1998 | Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxb8b, hoxb6b, hoxb5b, and hoxb1b are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG12. | |
| hoxb6b | GENE | 12 | Amores et al., 1998 | Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxb8b, hoxb6b, hoxb5b, and hoxb1b are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG12. | |
| hoxb5b | GENE | 12 | Amores et al., 1998 | Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxb8b, hoxb6b, hoxb5b, and hoxb1b are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG12. | |
| mir10a | MIRNAG | 12 | Woltering et al., 2006 | Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10a between hoxb1b and hoxb5b. | |
| hoxb5b | GENE | 12 | Woltering et al., 2006 | Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10a between hoxb1b and hoxb5b. |
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 693 | AluI | 36.0 |
| Forward Primer | GACAGTGACAGCGACTCCAA | ||
| Reverse Primer | TAATTGACCGGACGACAACA |
| Genomic Feature fh286 is an allele of hoxb1b |