| ZFIN ID: ZDB-GENE-051010-1 |
| Gene Name: | Indian hedgehog signaling molecule a |
|---|---|
| Symbol: | ihha |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||||||
|
| Mapped Clones containing ihha | |
|---|---|
| CH211-67P4 | Chr: 9 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| hu2131 | 9 | 7,434,452 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 9 | 7,359,197 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 9 | 7,380,806 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 9 | 7,400,713 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| sa30645 | 9 | 7,442,404 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 9 | 7,367,078 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 9 | 7,388,687 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 9 | 7,408,594 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| sa34554 | 9 | 7,442,497 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 9 | 7,367,171 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 9 | 7,388,780 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 9 | 7,408,687 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| hu2131 | 9 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| sa30645 | 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | ||
| 9 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| sa34554 | 9 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 9 | 51.1 cM | hha | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 9 | 492.0 cR | ihha | Goodfellow T51 (T51) | Geisler, Robert | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 545 | MseI | 36.0 |
| Forward Primer | CTTAACTGCAAATACGTGTGAATG | ||
| Reverse Primer | TCTTGTTGAACCTGCTGTCG |
| Genomic Feature hu2131 is an allele of ihha |